Mutagenetix > Incidental Mutation

Incidental Mutation 'R9718:Slx4'

730633

Institutional Source

Beutler Lab

Gene Symbol

Slx4

Ensembl Gene

ENSMUSG00000039738

Gene Name

SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)

Synonyms

Btbd12, D16Bwg1016e

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9718 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3979105-4003770 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 3986464 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 829 (P829T)

Ref Sequence

ENSEMBL: ENSMUSP00000038871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040790]

AlphaFold

Q6P1D7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040790
AA Change: P829T

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000038871
Gene: ENSMUSG00000039738
AA Change: P829T

Domain	Start	End	E-Value	Type
low complexity region	400	413	N/A	INTRINSIC
BTB	506	609	6.15e-7	SMART
low complexity region	651	667	N/A	INTRINSIC
low complexity region	833	849	N/A	INTRINSIC
low complexity region	857	875	N/A	INTRINSIC
low complexity region	1176	1192	N/A	INTRINSIC
low complexity region	1437	1461	N/A	INTRINSIC
Pfam:Slx4	1484	1541	3e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000146569

SMART Domains

Protein: ENSMUSP00000126423
Gene: ENSMUSG00000039738

Domain	Start	End	E-Value	Type
Pfam:BTB	6	102	6.7e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156542

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein containing a BTB (POZ) domain that comprises a subunit of structure-specific endonucleases. The encoded protein aids in the resolution of DNA secondary structures that arise during the processes of DNA repair and recombination. Knock out of this gene in mouse recapitulates the phenotype of the human disease Fanconi anemia, including blood cytopenia and susceptibility to genomic instability. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit some preweaning lethality, reduced fertility, abnormal eye morphology, abnormal skeletal morphology, hydrocephalus, chromosomal instability, early cellular replicative senescence, and abnormal lymphopoeisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430097D07Rik	A	C	2: 32,575,235		probably benign	Het
Acvr1c	A	T	2: 58,315,995	D34E	probably benign	Het
Arhgef19	T	C	4: 141,249,292	V455A	probably damaging	Het
Cbfa2t3	T	A	8: 122,638,197	D282V	probably benign	Het
Ccl9	T	A	11: 83,575,412	N114I	probably benign	Het
Cdan1	G	T	2: 120,724,169	A875E	probably damaging	Het
Celf2	A	T	2: 6,721,538	F61L	probably damaging	Het
Chd9	T	C	8: 90,986,173	Y875H	unknown	Het
Ckap5	A	T	2: 91,548,832	K39M	probably benign	Het
Clcn3	T	C	8: 60,937,400	H169R	possibly damaging	Het
Csmd3	C	A	15: 47,696,687	V1416F		Het
Cyp4v3	A	T	8: 45,320,666	H155Q	probably damaging	Het
Dhx36	A	G	3: 62,472,045	F874S	possibly damaging	Het
Dnah14	A	T	1: 181,622,979	Q719L	probably benign	Het
Evi2	C	T	11: 79,515,757	V331M	probably damaging	Het
Fcgrt	T	G	7: 45,095,429	E205A	possibly damaging	Het
Fkrp	G	T	7: 16,811,187	T250N	probably benign	Het
Galc	G	A	12: 98,259,314	P6S		Het
Gm13420	A	T	2: 29,747,536	L42Q	probably damaging	Het
Gm5134	A	T	10: 75,992,497	M304L	possibly damaging	Het
Gm813	A	G	16: 58,614,611	L117S	probably benign	Het
Haao	T	C	17: 83,834,786	E208G	probably damaging	Het
Hook1	T	A	4: 96,016,441	H553Q	probably benign	Het
Igdcc3	A	G	9: 65,182,998		probably null	Het
Ighv10-3	C	T	12: 114,523,634	V56I	probably benign	Het
Ighv1-62-1	G	T	12: 115,387,085	A15E	probably benign	Het
Krtap24-1	T	C	16: 88,611,490	*249W	probably null	Het
Ktn1	T	G	14: 47,673,051	I318R	probably damaging	Het
L3mbtl2	A	G	15: 81,687,922	T710A	unknown	Het
Ldha	A	T	7: 46,855,032	Q326L	possibly damaging	Het
Map4	G	A	9: 110,072,706		probably null	Het
Mdfic	T	A	6: 15,770,515	H173Q	probably damaging	Het
Noxred1	T	A	12: 87,224,918	Q159L	possibly damaging	Het
Olfr114	C	T	17: 37,590,023	G110D	probably benign	Het
Olfr584	T	C	7: 103,085,989	V152A	probably benign	Het
Omd	T	C	13: 49,589,860	S129P	probably damaging	Het
Parp16	A	G	9: 65,233,727	Y193C	probably damaging	Het
Pdzk1	A	G	3: 96,855,858	T201A		Het
Phldb2	T	A	16: 45,781,393	H728L	possibly damaging	Het
Ptchd4	C	T	17: 42,502,750	T514I	probably damaging	Het
Pusl1	T	C	4: 155,891,637	D24G	probably benign	Het
Rai1	G	A	11: 60,189,339	A1410T	probably benign	Het
Rint1	T	A	5: 23,800,723	H134Q	possibly damaging	Het
Rnf170	A	G	8: 26,129,215	S156G	unknown	Het
Rtf1	A	G	2: 119,705,505	D180G	possibly damaging	Het
Sectm1a	G	T	11: 121,069,664	D108E	probably damaging	Het
Senp7	T	A	16: 56,123,914	D200E	probably damaging	Het
Sfswap	A	G	5: 129,539,784	S431G	probably benign	Het
Sh3bp4	T	A	1: 89,145,750	D773E	probably damaging	Het
Shprh	T	C	10: 11,213,504	L1662P	probably damaging	Het
Snapc4	A	T	2: 26,378,521	S43T	probably damaging	Het
Ssh3	C	T	19: 4,262,409	R636Q	probably benign	Het
Strn4	G	A	7: 16,838,571	V679M	probably damaging	Het
Tas2r121	T	G	6: 132,700,802	Y69S	probably benign	Het
Tcerg1	C	T	18: 42,530,771	T341M	unknown	Het
Tjp2	A	C	19: 24,100,843	S895R	probably damaging	Het
Tmem220	G	T	11: 67,025,260	A28S	probably damaging	Het
Trdv1	G	A	14: 53,882,206	C109Y	probably damaging	Het
Trpc6	A	G	9: 8,634,189	Y423C	probably damaging	Het
Ttn	T	C	2: 76,794,683	M15184V	possibly damaging	Het
Ugt2b37	T	A	5: 87,242,943	Y355F	probably benign	Het
Vnn3	C	T	10: 23,869,556	R468*	probably null	Het
Washc5	T	A	15: 59,345,343	T792S	probably benign	Het
Wdfy4	T	C	14: 33,125,936	M820V		Het
Zfp961	T	A	8: 71,968,089	C149S	possibly damaging	Het
Zmat4	G	A	8: 23,748,491	V30M	probably damaging	Het

Other mutations in Slx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Slx4	APN	16	3990888	missense	probably benign	0.17
IGL01767:Slx4	APN	16	3990248	missense	probably benign	0.01
IGL02525:Slx4	APN	16	3980597	missense	probably damaging	1.00
slim	UTSW	16	3990910	nonsense	probably null
R0033:Slx4	UTSW	16	3988000	missense	probably benign	0.08
R0070:Slx4	UTSW	16	3988016	missense	possibly damaging	0.71
R0070:Slx4	UTSW	16	3988016	missense	possibly damaging	0.71
R0242:Slx4	UTSW	16	3986952	missense	probably damaging	0.99
R0242:Slx4	UTSW	16	3986952	missense	probably damaging	0.99
R0363:Slx4	UTSW	16	3980089	missense	probably damaging	1.00
R0433:Slx4	UTSW	16	3986018	missense	probably benign	0.01
R0993:Slx4	UTSW	16	3985825	missense	probably benign	0.00
R1083:Slx4	UTSW	16	3990910	nonsense	probably null
R1373:Slx4	UTSW	16	3985510	missense	probably benign	0.02
R1710:Slx4	UTSW	16	3999158	missense	probably benign	0.15
R1712:Slx4	UTSW	16	3991594	missense	probably damaging	0.99
R1874:Slx4	UTSW	16	3986848	missense	probably benign	0.25
R1937:Slx4	UTSW	16	3987166	makesense	probably null
R2008:Slx4	UTSW	16	3979921	missense	probably damaging	1.00
R2156:Slx4	UTSW	16	3986359	missense	probably benign	0.00
R2427:Slx4	UTSW	16	3988987	missense	probably damaging	0.99
R3765:Slx4	UTSW	16	3980986	missense	probably damaging	1.00
R3890:Slx4	UTSW	16	3979909	missense	probably damaging	1.00
R3891:Slx4	UTSW	16	3979909	missense	probably damaging	1.00
R4465:Slx4	UTSW	16	3989055	missense	possibly damaging	0.82
R4467:Slx4	UTSW	16	3989055	missense	possibly damaging	0.82
R4497:Slx4	UTSW	16	3994909	missense	probably damaging	1.00
R4882:Slx4	UTSW	16	3980996	critical splice acceptor site	probably null
R5119:Slx4	UTSW	16	4001199	missense	possibly damaging	0.89
R5384:Slx4	UTSW	16	3990805	missense	probably damaging	1.00
R5472:Slx4	UTSW	16	3991540	missense	probably benign	0.13
R5578:Slx4	UTSW	16	3986862	missense	probably damaging	1.00
R5582:Slx4	UTSW	16	3985788	missense	possibly damaging	0.93
R5696:Slx4	UTSW	16	3979967	missense	probably damaging	1.00
R5827:Slx4	UTSW	16	4001284	missense	possibly damaging	0.94
R5964:Slx4	UTSW	16	4000951	critical splice donor site	probably null
R6032:Slx4	UTSW	16	3980157	missense	probably damaging	1.00
R6032:Slx4	UTSW	16	3980157	missense	probably damaging	1.00
R6039:Slx4	UTSW	16	3986047	missense	possibly damaging	0.82
R6039:Slx4	UTSW	16	3986047	missense	possibly damaging	0.82
R6345:Slx4	UTSW	16	3990850	missense	probably benign	0.06
R6612:Slx4	UTSW	16	3985276	missense	probably damaging	0.99
R6979:Slx4	UTSW	16	3985015	missense	probably damaging	0.96
R6989:Slx4	UTSW	16	3995838	missense	probably damaging	1.00
R7171:Slx4	UTSW	16	3990786	missense	probably benign
R7214:Slx4	UTSW	16	3988980	missense	probably benign	0.18
R7354:Slx4	UTSW	16	3987099	missense	probably benign	0.28
R7490:Slx4	UTSW	16	3980131	missense	possibly damaging	0.91
R7545:Slx4	UTSW	16	3999300	missense	probably benign	0.11
R7547:Slx4	UTSW	16	3985572	missense	probably benign	0.05
R7790:Slx4	UTSW	16	3986982	missense	probably benign	0.03
R8119:Slx4	UTSW	16	3985272	nonsense	probably null
R8815:Slx4	UTSW	16	3985594	missense	probably benign	0.26
R8955:Slx4	UTSW	16	3990247	missense	probably benign
R9205:Slx4	UTSW	16	3988063	missense	possibly damaging	0.74
R9321:Slx4	UTSW	16	3986790	missense	probably benign	0.06
R9364:Slx4	UTSW	16	3987956	missense	probably benign	0.00
R9544:Slx4	UTSW	16	3980053	missense	probably damaging	0.97
R9554:Slx4	UTSW	16	3987956	missense	probably benign	0.00
R9632:Slx4	UTSW	16	3986105	missense	probably benign	0.00
R9665:Slx4	UTSW	16	3989026	missense	probably benign	0.28
R9772:Slx4	UTSW	16	4000985	missense

Predicted Primers

PCR Primer
(F):5'- TGTGACAATGTTACTGCCCC -3'
(R):5'- ATTCCACTCCACTGCAGGAC -3'

Sequencing Primer
(F):5'- CCTCCTCTGCTTAGTTGGTGTAG -3'
(R):5'- CAGAGGCCCAGGATGCATTG -3'

Posted On

2022-10-06