Incidental Mutation 'R9718:Haao'
ID 730640
Institutional Source Beutler Lab
Gene Symbol Haao
Ensembl Gene ENSMUSG00000000673
Gene Name 3-hydroxyanthranilate 3,4-dioxygenase
Synonyms 3HAO, 0610012J07Rik, 0610007K21Rik, 3-HAO, 3-HAOxase
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9718 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 83831356-83846790 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83834786 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 208 (E208G)
Ref Sequence ENSEMBL: ENSMUSP00000000687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000687]
AlphaFold Q78JT3
Predicted Effect probably damaging
Transcript: ENSMUST00000000687
AA Change: E208G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000687
Gene: ENSMUSG00000000673
AA Change: E208G

DomainStartEndE-ValueType
Pfam:3-HAO 1 149 1e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 3-Hydroxyanthranilate 3,4-dioxygenase is a monomeric cytosolic protein belonging to the family of intramolecular dioxygenases containing nonheme ferrous iron. It is widely distributed in peripheral organs, such as liver and kidney, and is also present in low amounts in the central nervous system. HAAO catalyzes the synthesis of quinolinic acid (QUIN) from 3-hydroxyanthranilic acid. QUIN is an excitotoxin whose toxicity is mediated by its ability to activate glutamate N-methyl-D-aspartate receptors. Increased cerebral levels of QUIN may participate in the pathogenesis of neurologic and inflammatory disorders. HAAO has been suggested to play a role in disorders associated with altered tissue levels of QUIN. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced LPS-induced depressive behaviors and altered kynurenine metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik A C 2: 32,575,235 probably benign Het
Acvr1c A T 2: 58,315,995 D34E probably benign Het
Arhgef19 T C 4: 141,249,292 V455A probably damaging Het
Cbfa2t3 T A 8: 122,638,197 D282V probably benign Het
Ccl9 T A 11: 83,575,412 N114I probably benign Het
Cdan1 G T 2: 120,724,169 A875E probably damaging Het
Celf2 A T 2: 6,721,538 F61L probably damaging Het
Chd9 T C 8: 90,986,173 Y875H unknown Het
Ckap5 A T 2: 91,548,832 K39M probably benign Het
Clcn3 T C 8: 60,937,400 H169R possibly damaging Het
Csmd3 C A 15: 47,696,687 V1416F Het
Cyp4v3 A T 8: 45,320,666 H155Q probably damaging Het
Dhx36 A G 3: 62,472,045 F874S possibly damaging Het
Dnah14 A T 1: 181,622,979 Q719L probably benign Het
Evi2 C T 11: 79,515,757 V331M probably damaging Het
Fcgrt T G 7: 45,095,429 E205A possibly damaging Het
Fkrp G T 7: 16,811,187 T250N probably benign Het
Galc G A 12: 98,259,314 P6S Het
Gm13420 A T 2: 29,747,536 L42Q probably damaging Het
Gm5134 A T 10: 75,992,497 M304L possibly damaging Het
Gm813 A G 16: 58,614,611 L117S probably benign Het
Hook1 T A 4: 96,016,441 H553Q probably benign Het
Igdcc3 A G 9: 65,182,998 probably null Het
Ighv10-3 C T 12: 114,523,634 V56I probably benign Het
Ighv1-62-1 G T 12: 115,387,085 A15E probably benign Het
Krtap24-1 T C 16: 88,611,490 *249W probably null Het
Ktn1 T G 14: 47,673,051 I318R probably damaging Het
L3mbtl2 A G 15: 81,687,922 T710A unknown Het
Ldha A T 7: 46,855,032 Q326L possibly damaging Het
Map4 G A 9: 110,072,706 probably null Het
Mdfic T A 6: 15,770,515 H173Q probably damaging Het
Noxred1 T A 12: 87,224,918 Q159L possibly damaging Het
Olfr114 C T 17: 37,590,023 G110D probably benign Het
Olfr584 T C 7: 103,085,989 V152A probably benign Het
Omd T C 13: 49,589,860 S129P probably damaging Het
Parp16 A G 9: 65,233,727 Y193C probably damaging Het
Pdzk1 A G 3: 96,855,858 T201A Het
Phldb2 T A 16: 45,781,393 H728L possibly damaging Het
Ptchd4 C T 17: 42,502,750 T514I probably damaging Het
Pusl1 T C 4: 155,891,637 D24G probably benign Het
Rai1 G A 11: 60,189,339 A1410T probably benign Het
Rint1 T A 5: 23,800,723 H134Q possibly damaging Het
Rnf170 A G 8: 26,129,215 S156G unknown Het
Rtf1 A G 2: 119,705,505 D180G possibly damaging Het
Sectm1a G T 11: 121,069,664 D108E probably damaging Het
Senp7 T A 16: 56,123,914 D200E probably damaging Het
Sfswap A G 5: 129,539,784 S431G probably benign Het
Sh3bp4 T A 1: 89,145,750 D773E probably damaging Het
Shprh T C 10: 11,213,504 L1662P probably damaging Het
Slx4 G T 16: 3,986,464 P829T possibly damaging Het
Snapc4 A T 2: 26,378,521 S43T probably damaging Het
Ssh3 C T 19: 4,262,409 R636Q probably benign Het
Strn4 G A 7: 16,838,571 V679M probably damaging Het
Tas2r121 T G 6: 132,700,802 Y69S probably benign Het
Tcerg1 C T 18: 42,530,771 T341M unknown Het
Tjp2 A C 19: 24,100,843 S895R probably damaging Het
Tmem220 G T 11: 67,025,260 A28S probably damaging Het
Trdv1 G A 14: 53,882,206 C109Y probably damaging Het
Trpc6 A G 9: 8,634,189 Y423C probably damaging Het
Ttn T C 2: 76,794,683 M15184V possibly damaging Het
Ugt2b37 T A 5: 87,242,943 Y355F probably benign Het
Vnn3 C T 10: 23,869,556 R468* probably null Het
Washc5 T A 15: 59,345,343 T792S probably benign Het
Wdfy4 T C 14: 33,125,936 M820V Het
Zfp961 T A 8: 71,968,089 C149S possibly damaging Het
Zmat4 G A 8: 23,748,491 V30M probably damaging Het
Other mutations in Haao
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Haao APN 17 83834930 splice site probably benign
IGL01728:Haao APN 17 83835229 missense probably damaging 1.00
IGL02603:Haao APN 17 83835541 missense probably benign 0.45
IGL03328:Haao APN 17 83846649 missense probably damaging 1.00
R0635:Haao UTSW 17 83838574 missense probably damaging 1.00
R1295:Haao UTSW 17 83838838 missense probably benign 0.38
R1296:Haao UTSW 17 83838838 missense probably benign 0.38
R1472:Haao UTSW 17 83838838 missense probably benign 0.38
R1563:Haao UTSW 17 83834889 missense probably benign 0.01
R2424:Haao UTSW 17 83835562 missense probably damaging 0.99
R3917:Haao UTSW 17 83838799 critical splice donor site probably null
R4657:Haao UTSW 17 83832345 missense possibly damaging 0.67
R4857:Haao UTSW 17 83838580 critical splice acceptor site probably null
R6475:Haao UTSW 17 83831684 missense possibly damaging 0.87
R6989:Haao UTSW 17 83831674 missense probably damaging 1.00
R7390:Haao UTSW 17 83846652 missense probably damaging 0.99
R8073:Haao UTSW 17 83835220 missense possibly damaging 0.86
R9309:Haao UTSW 17 83838841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGGAAGGCCGTTCTCATG -3'
(R):5'- GGTCACTCTCCATCACTGTG -3'

Sequencing Primer
(F):5'- GCCGTTCTCATGCCTCTGAAG -3'
(R):5'- ATCACTGTGTCACTGGCG -3'
Posted On 2022-10-06