Incidental Mutation 'R9719:Scel'
ID 730682
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Name sciellin
Synonyms 9230114I02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9719 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 103513342-103612797 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 103572006 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
AlphaFold Q9EQG3
Predicted Effect probably null
Transcript: ENSMUST00000095576
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227322
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G T 9: 103,254,815 P569H probably benign Het
1700015G11Rik T C 7: 52,014,864 T28A probably benign Het
4931408C20Rik C G 1: 26,683,739 E787Q probably benign Het
Alppl2 T A 1: 87,088,414 Q241L probably benign Het
Apob T A 12: 8,015,464 N4144K probably benign Het
B4gat1 A G 19: 5,040,488 H413R probably benign Het
Ceacam5 A C 7: 17,757,910 D735A probably damaging Het
Col18a1 C T 10: 77,113,598 D27N unknown Het
Colgalt1 A G 8: 71,620,812 E359G probably benign Het
Crybg2 T A 4: 134,065,837 I261N probably benign Het
Cyyr1 A T 16: 85,422,315 L68Q unknown Het
Dgkz T A 2: 91,938,566 probably null Het
Eif2ak2 C A 17: 78,855,354 D472Y probably damaging Het
Elp2 A G 18: 24,622,482 T429A possibly damaging Het
Fen1 G A 19: 10,200,652 H143Y probably benign Het
Gm10518 C A 1: 179,803,548 R58S unknown Het
Gm11639 A T 11: 104,977,086 E3947V unknown Het
Gm14124 T A 2: 150,269,384 C665S possibly damaging Het
Hspa1b T C 17: 34,957,491 D506G probably damaging Het
Kcna7 A G 7: 45,406,966 D202G probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Mal C T 2: 127,656,105 S10N possibly damaging Het
Mgat2 T A 12: 69,185,341 W230R probably damaging Het
Myo3a A T 2: 22,544,455 T883S probably benign Het
Ncaph2 T C 15: 89,365,323 S277P probably benign Het
Olfm3 G A 3: 115,122,442 W341* probably null Het
Olfr1176 T A 2: 88,339,584 N6K Het
Olfr1348 C A 7: 6,502,000 M75I probably benign Het
Olfr1475 A G 19: 13,480,004 S65P probably damaging Het
Olfr154 T A 2: 85,664,264 I57F probably benign Het
Olfr29-ps1 A C 4: 43,781,454 M292R probably damaging Het
Olfr59 A C 11: 74,289,320 I225L probably damaging Het
Pcnx4 T C 12: 72,556,265 Y434H probably damaging Het
Ptpn14 T A 1: 189,851,287 M777K probably benign Het
Rasef A G 4: 73,769,865 I17T possibly damaging Het
Rptor A T 11: 119,891,114 D1089V probably benign Het
Scfd2 A T 5: 74,225,343 L605Q probably damaging Het
Son A G 16: 91,659,552 E1729G probably damaging Het
Spout1 A G 2: 30,175,801 Y243H probably benign Het
Syne1 A G 10: 5,326,601 F1765S possibly damaging Het
Tet2 A T 3: 133,486,042 V877E possibly damaging Het
Txn2 T C 15: 77,928,089 probably benign Het
Vmn1r158 T C 7: 22,789,906 I293V possibly damaging Het
Vmn1r81 G A 7: 12,260,522 T53I probably damaging Het
Vps18 T C 2: 119,297,072 F792S probably damaging Het
Vps25 A G 11: 101,256,027 D91G probably null Het
Wdr26 G A 1: 181,187,659 L396F possibly damaging Het
Zfp26 T C 9: 20,436,565 E901G possibly damaging Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6045:Scel UTSW 14 103592213 missense probably benign 0.12
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
R8924:Scel UTSW 14 103592371 missense possibly damaging 0.66
R9014:Scel UTSW 14 103585139 missense probably benign
R9130:Scel UTSW 14 103533310 missense probably benign 0.05
R9135:Scel UTSW 14 103602190 missense probably benign
R9179:Scel UTSW 14 103574400 missense possibly damaging 0.79
R9614:Scel UTSW 14 103605596 missense probably damaging 1.00
R9638:Scel UTSW 14 103541973 missense possibly damaging 0.89
R9672:Scel UTSW 14 103599402 missense possibly damaging 0.82
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CCTTGCTGCTTCAGATGGTG -3'
(R):5'- GTCACCTAGGTTGCACACTTC -3'

Sequencing Primer
(F):5'- CGAGCACTCCAGCAGATG -3'
(R):5'- TGACTAGGTCACTGACATCATGACG -3'
Posted On 2022-10-06