Mutagenetix > Incidental Mutation

Incidental Mutation 'R9719:Scel'

730682

Institutional Source

Beutler Lab

Gene Symbol

Scel

Ensembl Gene

ENSMUSG00000022123

Gene Name

sciellin

Synonyms

9230114I02Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9719 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103513342-103612797 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 103572006 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000093233 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]

AlphaFold

Q9EQG3

Predicted Effect

probably null
Transcript: ENSMUST00000095576

SMART Domains

Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123

Domain	Start	End	E-Value	Type
low complexity region	111	131	N/A	INTRINSIC
low complexity region	159	178	N/A	INTRINSIC
internal_repeat_1	204	327	9.24e-7	PROSPERO
internal_repeat_1	378	505	9.24e-7	PROSPERO
low complexity region	525	537	N/A	INTRINSIC
LIM	584	642	2.23e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227322

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	G	T	9: 103,254,815	P569H	probably benign	Het
1700015G11Rik	T	C	7: 52,014,864	T28A	probably benign	Het
4931408C20Rik	C	G	1: 26,683,739	E787Q	probably benign	Het
Alppl2	T	A	1: 87,088,414	Q241L	probably benign	Het
Apob	T	A	12: 8,015,464	N4144K	probably benign	Het
B4gat1	A	G	19: 5,040,488	H413R	probably benign	Het
Ceacam5	A	C	7: 17,757,910	D735A	probably damaging	Het
Col18a1	C	T	10: 77,113,598	D27N	unknown	Het
Colgalt1	A	G	8: 71,620,812	E359G	probably benign	Het
Crybg2	T	A	4: 134,065,837	I261N	probably benign	Het
Cyyr1	A	T	16: 85,422,315	L68Q	unknown	Het
Dgkz	T	A	2: 91,938,566		probably null	Het
Eif2ak2	C	A	17: 78,855,354	D472Y	probably damaging	Het
Elp2	A	G	18: 24,622,482	T429A	possibly damaging	Het
Fen1	G	A	19: 10,200,652	H143Y	probably benign	Het
Gm10518	C	A	1: 179,803,548	R58S	unknown	Het
Gm11639	A	T	11: 104,977,086	E3947V	unknown	Het
Gm14124	T	A	2: 150,269,384	C665S	possibly damaging	Het
Hspa1b	T	C	17: 34,957,491	D506G	probably damaging	Het
Kcna7	A	G	7: 45,406,966	D202G	probably benign	Het
Krt9	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC	11: 100,189,077		probably benign	Het
Mal	C	T	2: 127,656,105	S10N	possibly damaging	Het
Mgat2	T	A	12: 69,185,341	W230R	probably damaging	Het
Myo3a	A	T	2: 22,544,455	T883S	probably benign	Het
Ncaph2	T	C	15: 89,365,323	S277P	probably benign	Het
Olfm3	G	A	3: 115,122,442	W341*	probably null	Het
Olfr1176	T	A	2: 88,339,584	N6K		Het
Olfr1348	C	A	7: 6,502,000	M75I	probably benign	Het
Olfr1475	A	G	19: 13,480,004	S65P	probably damaging	Het
Olfr154	T	A	2: 85,664,264	I57F	probably benign	Het
Olfr29-ps1	A	C	4: 43,781,454	M292R	probably damaging	Het
Olfr59	A	C	11: 74,289,320	I225L	probably damaging	Het
Pcnx4	T	C	12: 72,556,265	Y434H	probably damaging	Het
Ptpn14	T	A	1: 189,851,287	M777K	probably benign	Het
Rasef	A	G	4: 73,769,865	I17T	possibly damaging	Het
Rptor	A	T	11: 119,891,114	D1089V	probably benign	Het
Scfd2	A	T	5: 74,225,343	L605Q	probably damaging	Het
Son	A	G	16: 91,659,552	E1729G	probably damaging	Het
Spout1	A	G	2: 30,175,801	Y243H	probably benign	Het
Syne1	A	G	10: 5,326,601	F1765S	possibly damaging	Het
Tet2	A	T	3: 133,486,042	V877E	possibly damaging	Het
Txn2	T	C	15: 77,928,089		probably benign	Het
Vmn1r158	T	C	7: 22,789,906	I293V	possibly damaging	Het
Vmn1r81	G	A	7: 12,260,522	T53I	probably damaging	Het
Vps18	T	C	2: 119,297,072	F792S	probably damaging	Het
Vps25	A	G	11: 101,256,027	D91G	probably null	Het
Wdr26	G	A	1: 181,187,659	L396F	possibly damaging	Het
Zfp26	T	C	9: 20,436,565	E901G	possibly damaging	Het

Other mutations in Scel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Scel	APN	14	103529995	missense	probably benign	0.01
IGL00913:Scel	APN	14	103581809	missense	probably benign	0.35
IGL01086:Scel	APN	14	103612391	missense	probably benign	0.05
IGL01352:Scel	APN	14	103533338	missense	possibly damaging	0.54
IGL01396:Scel	APN	14	103608094	splice site	probably benign
IGL01954:Scel	APN	14	103603242	splice site	probably benign
IGL02064:Scel	APN	14	103533326	missense	probably damaging	0.98
IGL02186:Scel	APN	14	103564821	missense	probably benign	0.23
IGL02475:Scel	APN	14	103537008	missense	possibly damaging	0.95
IGL02926:Scel	APN	14	103576247	nonsense	probably null
IGL03122:Scel	APN	14	103599406	missense	possibly damaging	0.66
IGL03135:Scel	APN	14	103586514	missense	probably benign	0.02
PIT4585001:Scel	UTSW	14	103592368	missense	possibly damaging	0.90
R0346:Scel	UTSW	14	103529984	missense	probably damaging	1.00
R0394:Scel	UTSW	14	103562518	missense	probably benign	0.15
R0418:Scel	UTSW	14	103603254	missense	probably benign
R0635:Scel	UTSW	14	103583139	critical splice donor site	probably null
R0815:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0863:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0990:Scel	UTSW	14	103581832	missense	possibly damaging	0.55
R1084:Scel	UTSW	14	103564843	critical splice donor site	probably null
R1641:Scel	UTSW	14	103533316	missense	probably damaging	1.00
R2001:Scel	UTSW	14	103610790	missense	possibly damaging	0.66
R2002:Scel	UTSW	14	103541985	missense	probably damaging	1.00
R2341:Scel	UTSW	14	103608170	missense	possibly damaging	0.92
R3425:Scel	UTSW	14	103608106	missense	possibly damaging	0.92
R3836:Scel	UTSW	14	103592386	missense	possibly damaging	0.66
R4035:Scel	UTSW	14	103530004	missense	probably damaging	1.00
R4197:Scel	UTSW	14	103599400	missense	probably damaging	0.97
R4737:Scel	UTSW	14	103572037	missense	possibly damaging	0.79
R4801:Scel	UTSW	14	103583100	missense	probably benign	0.01
R4802:Scel	UTSW	14	103583100	missense	probably benign	0.01
R5369:Scel	UTSW	14	103586493	missense	probably benign	0.00
R5555:Scel	UTSW	14	103602206	missense	probably benign	0.27
R5582:Scel	UTSW	14	103583139	critical splice donor site	probably benign
R5931:Scel	UTSW	14	103605624	nonsense	probably null
R5978:Scel	UTSW	14	103529254	splice site	probably null
R6045:Scel	UTSW	14	103592213	missense	probably benign	0.12
R6062:Scel	UTSW	14	103585136	missense	possibly damaging	0.82
R6218:Scel	UTSW	14	103572042	missense	probably benign	0.12
R6225:Scel	UTSW	14	103591984	missense	probably benign	0.27
R7102:Scel	UTSW	14	103543832	nonsense	probably null
R7349:Scel	UTSW	14	103543879	missense	probably benign	0.11
R8376:Scel	UTSW	14	103572015	missense	probably benign	0.02
R8924:Scel	UTSW	14	103592371	missense	possibly damaging	0.66
R9014:Scel	UTSW	14	103585139	missense	probably benign
R9130:Scel	UTSW	14	103533310	missense	probably benign	0.05
R9135:Scel	UTSW	14	103602190	missense	probably benign
R9179:Scel	UTSW	14	103574400	missense	possibly damaging	0.79
R9614:Scel	UTSW	14	103605596	missense	probably damaging	1.00
R9638:Scel	UTSW	14	103541973	missense	possibly damaging	0.89
R9672:Scel	UTSW	14	103599402	missense	possibly damaging	0.82
X0026:Scel	UTSW	14	103591993	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- CCTTGCTGCTTCAGATGGTG -3'
(R):5'- GTCACCTAGGTTGCACACTTC -3'

Sequencing Primer
(F):5'- CGAGCACTCCAGCAGATG -3'
(R):5'- TGACTAGGTCACTGACATCATGACG -3'

Posted On

2022-10-06