Mutagenetix > Incidental Mutation

Incidental Mutation 'R9720:Nphs1'

730718

Institutional Source

Beutler Lab

Gene Symbol

Nphs1

Ensembl Gene

ENSMUSG00000006649

Gene Name

nephrosis 1, nephrin

Synonyms

nephrin

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9720 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30458315-30487223 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30466074 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 622 (V622A)

Ref Sequence

ENSEMBL: ENSMUSP00000006825 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]

AlphaFold

Q9QZS7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006825
AA Change: V622A

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: V622A

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
IG	52	146	1.38e-6	SMART
Pfam:C2-set_2	152	242	4.1e-20	PFAM
IG	264	351	9.86e-3	SMART
IG_like	360	452	2.73e1	SMART
IG	464	556	2.99e-2	SMART
IG_like	572	644	8.9e-1	SMART
IG	667	751	1.32e-3	SMART
IG	760	849	7.3e-6	SMART
IGc2	868	941	5.4e-9	SMART
FN3	955	1036	1.01e-11	SMART
transmembrane domain	1078	1100	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000126297
AA Change: V608A

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: V608A

Domain	Start	End	E-Value	Type
IG	38	132	1.38e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	G	11: 84,263,357	V968G	probably damaging	Het
Adam33	A	G	2: 131,058,316	V110A		Het
Adamts2	T	C	11: 50,776,127	M417T	probably damaging	Het
Adgrv1	A	G	13: 81,592,574	I145T	probably damaging	Het
Ampd3	C	A	7: 110,777,849	H16N	probably benign	Het
Ank3	A	T	10: 69,989,505	S1335C		Het
Ankrd26	G	A	6: 118,521,941	S1208L	probably damaging	Het
Atmin	G	A	8: 116,954,914		probably null	Het
AU018091	T	C	7: 3,159,432	T323A	probably benign	Het
Barx2	A	G	9: 31,854,111		probably null	Het
Brpf3	A	G	17: 28,807,356	I468V	probably benign	Het
Cacna1g	T	A	11: 94,411,471	H1985L	probably benign	Het
Cass4	T	C	2: 172,427,648	V550A	probably benign	Het
Ccdc88a	A	G	11: 29,463,813	S784G	probably benign	Het
Cd300ld2	C	T	11: 115,012,292		probably null	Het
Cgn	G	A	3: 94,779,311	A227V	probably benign	Het
Clcn7	G	T	17: 25,155,497	R524L	probably damaging	Het
Cldn22	G	A	8: 47,824,751	A75T	probably benign	Het
Ddb1	A	G	19: 10,608,360	D146G	probably benign	Het
Dhx32	C	A	7: 133,723,128	E607*	probably null	Het
Egfem1	A	G	3: 29,662,431	Y350C	probably damaging	Het
Eri2	T	A	7: 119,787,753	D181V	probably damaging	Het
Gabrg2	T	C	11: 41,971,846	N137S	probably damaging	Het
Gar1	C	T	3: 129,826,848	G197S	unknown	Het
Ggta1	G	T	2: 35,413,406	D91E	probably benign	Het
Hap1	T	A	11: 100,355,870	I70F	probably benign	Het
Hars2	A	G	18: 36,787,554	Y150C	probably damaging	Het
Igsf9b	G	A	9: 27,309,514	V59I	probably damaging	Het
Il15	T	G	8: 82,331,979	K142Q	probably damaging	Het
Klhl23	T	C	2: 69,824,460	Y225H	possibly damaging	Het
Krt6b	T	A	15: 101,679,791	I145F	probably benign	Het
Lgals3bp	T	A	11: 118,393,257	T499S	probably benign	Het
Lrriq4	A	G	3: 30,659,928	N490S	probably damaging	Het
Ltbr	G	A	6: 125,307,385	R365W	probably damaging	Het
Mical3	A	G	6: 120,958,277	S1763P	probably damaging	Het
Ncoa6	A	G	2: 155,408,384	V1000A	probably damaging	Het
Nefm	A	G	14: 68,121,344	S414P	probably benign	Het
Olfr214	T	C	6: 116,557,055	V210A	possibly damaging	Het
Olfr809	T	C	10: 129,776,712	V281A	probably benign	Het
Pde4dip	T	C	3: 97,695,971	D2234G	probably damaging	Het
Pde6c	A	T	19: 38,169,439	Y637F	probably benign	Het
Pigg	T	A	5: 108,319,934	C266*	probably null	Het
Pkdrej	A	T	15: 85,818,296	D1146E	possibly damaging	Het
Pkp2	T	C	16: 16,269,720	V756A	probably benign	Het
Pole	C	T	5: 110,337,043	T2245I	probably benign	Het
Ppil2	T	C	16: 17,093,026	T259A	probably damaging	Het
Ppm1g	A	C	5: 31,203,570		probably null	Het
Ppp1r36	A	G	12: 76,438,524	I340M	possibly damaging	Het
Pvr	G	A	7: 19,909,196	R371*	probably null	Het
Rassf9	G	A	10: 102,512,508		probably benign	Het
Rtl1	A	C	12: 109,593,448	N652K	possibly damaging	Het
Sall4	G	C	2: 168,750,240	S998C	probably damaging	Het
Sdk1	T	C	5: 142,212,041	Y2150H	probably damaging	Het
Serpinb3b	A	T	1: 107,155,939	I170K	probably benign	Het
Shank2	A	T	7: 144,128,400	D390V	probably damaging	Het
Slc39a4	A	G	15: 76,616,730	V11A	probably benign	Het
Synj2	C	T	17: 5,990,309	T220I	probably benign	Het
Taar7a	A	G	10: 23,992,835	I216T	probably benign	Het
Tas2r122	G	T	6: 132,711,671	D86E	probably benign	Het
Tbxa2r	T	A	10: 81,333,184	C236S	probably benign	Het
Trav13-4-dv7	C	A	14: 53,757,829	T80K	probably benign	Het
Trav6d-5	T	A	14: 52,795,620	C109S	probably damaging	Het
Trio	A	G	15: 27,847,409	M982T	probably benign	Het
Uhrf1bp1l	T	A	10: 89,805,357	S797T	probably benign	Het
Unc80	A	T	1: 66,644,326	T2176S	possibly damaging	Het
Zfp120	A	T	2: 150,117,277	I397K	probably benign	Het

Other mutations in Nphs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Nphs1	APN	7	30482551	missense	possibly damaging	0.77
IGL00927:Nphs1	APN	7	30460739	unclassified	probably benign
IGL00976:Nphs1	APN	7	30460685	missense	possibly damaging	0.78
IGL01397:Nphs1	APN	7	30486664	missense	probably benign	0.01
IGL01465:Nphs1	APN	7	30486714	makesense	probably null
IGL01889:Nphs1	APN	7	30460511	missense	probably damaging	1.00
IGL02383:Nphs1	APN	7	30481635	splice site	probably benign
R0020:Nphs1	UTSW	7	30463208	missense	probably benign	0.01
R0485:Nphs1	UTSW	7	30467515	missense	probably benign
R1024:Nphs1	UTSW	7	30474277	missense	probably damaging	1.00
R1115:Nphs1	UTSW	7	30481378	splice site	probably benign
R1144:Nphs1	UTSW	7	30481678	splice site	probably benign
R1289:Nphs1	UTSW	7	30471178	missense	probably damaging	1.00
R1317:Nphs1	UTSW	7	30481831	splice site	probably benign
R1617:Nphs1	UTSW	7	30482531	missense	probably benign
R1756:Nphs1	UTSW	7	30461534	missense	probably benign	0.00
R1937:Nphs1	UTSW	7	30474373	missense	probably damaging	1.00
R2144:Nphs1	UTSW	7	30460970	missense	probably benign	0.13
R2256:Nphs1	UTSW	7	30467992	missense	possibly damaging	0.94
R2257:Nphs1	UTSW	7	30467992	missense	possibly damaging	0.94
R2277:Nphs1	UTSW	7	30467564	nonsense	probably null
R3104:Nphs1	UTSW	7	30467540	nonsense	probably null
R3106:Nphs1	UTSW	7	30467540	nonsense	probably null
R3151:Nphs1	UTSW	7	30460240	missense	probably benign
R3765:Nphs1	UTSW	7	30471210	missense	probably damaging	0.98
R4078:Nphs1	UTSW	7	30467520	nonsense	probably null
R4397:Nphs1	UTSW	7	30481965	splice site	probably null
R4635:Nphs1	UTSW	7	30468007	missense	probably benign	0.39
R4650:Nphs1	UTSW	7	30482470	missense	probably benign	0.21
R4811:Nphs1	UTSW	7	30460429	missense	probably damaging	1.00
R4850:Nphs1	UTSW	7	30463232	missense	possibly damaging	0.78
R5272:Nphs1	UTSW	7	30481642	missense	possibly damaging	0.86
R5327:Nphs1	UTSW	7	30463825	missense	probably benign	0.00
R5681:Nphs1	UTSW	7	30486625	missense	probably benign	0.00
R5865:Nphs1	UTSW	7	30474385	missense	probably damaging	1.00
R5975:Nphs1	UTSW	7	30466115	missense	possibly damaging	0.82
R6186:Nphs1	UTSW	7	30465634	missense	probably damaging	0.98
R6198:Nphs1	UTSW	7	30467915	missense	probably damaging	0.97
R6353:Nphs1	UTSW	7	30474544	missense	probably damaging	0.99
R7405:Nphs1	UTSW	7	30462828	missense	possibly damaging	0.46
R7647:Nphs1	UTSW	7	30481965	splice site	probably null
R7767:Nphs1	UTSW	7	30463308	missense	probably damaging	1.00
R8132:Nphs1	UTSW	7	30482053	missense	probably benign	0.02
R8485:Nphs1	UTSW	7	30466173	missense	probably damaging	0.98
R8678:Nphs1	UTSW	7	30463859	missense	probably damaging	1.00
R8890:Nphs1	UTSW	7	30462655	missense	probably damaging	1.00
R8946:Nphs1	UTSW	7	30463200	missense	probably damaging	1.00
R9133:Nphs1	UTSW	7	30460667	nonsense	probably null
R9159:Nphs1	UTSW	7	30465601	missense	possibly damaging	0.93
R9347:Nphs1	UTSW	7	30471169	missense	probably damaging	1.00
R9547:Nphs1	UTSW	7	30481450	missense	probably benign	0.00
R9548:Nphs1	UTSW	7	30481450	missense	probably benign	0.00
R9607:Nphs1	UTSW	7	30463587	missense	probably damaging	1.00
R9626:Nphs1	UTSW	7	30467566	missense	probably benign	0.16
R9733:Nphs1	UTSW	7	30467530	missense	probably damaging	1.00
X0028:Nphs1	UTSW	7	30467504	missense	probably null	0.01
Z1177:Nphs1	UTSW	7	30470903	missense	probably damaging	1.00
Z1186:Nphs1	UTSW	7	30460350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCAACCCTCCAGTTAACTTG -3'
(R):5'- TGAAGACTCCAGTAGCTGCC -3'

Sequencing Primer
(F):5'- TTATAGGAAACCCTATCCCGTCCATG -3'
(R):5'- TCCAGTAGCTGCCGTCTACAG -3'

Posted On

2022-10-06