Incidental Mutation 'R9720:Nphs1'
ID 730718
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9720 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30157740-30186648 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30165499 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 622 (V622A)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect possibly damaging
Transcript: ENSMUST00000006825
AA Change: V622A

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: V622A

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126297
AA Change: V608A

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: V608A

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,154,183 (GRCm39) V968G probably damaging Het
Adam33 A G 2: 130,900,236 (GRCm39) V110A Het
Adamts2 T C 11: 50,666,954 (GRCm39) M417T probably damaging Het
Adgrv1 A G 13: 81,740,693 (GRCm39) I145T probably damaging Het
Ampd3 C A 7: 110,377,056 (GRCm39) H16N probably benign Het
Ank3 A T 10: 69,825,335 (GRCm39) S1335C Het
Ankrd26 G A 6: 118,498,902 (GRCm39) S1208L probably damaging Het
Atmin G A 8: 117,681,653 (GRCm39) probably null Het
AU018091 T C 7: 3,209,272 (GRCm39) T323A probably benign Het
Barx2 A G 9: 31,765,407 (GRCm39) probably null Het
Bltp3b T A 10: 89,641,219 (GRCm39) S797T probably benign Het
Brpf3 A G 17: 29,026,330 (GRCm39) I468V probably benign Het
Cacna1g T A 11: 94,302,297 (GRCm39) H1985L probably benign Het
Cass4 T C 2: 172,269,568 (GRCm39) V550A probably benign Het
Ccdc88a A G 11: 29,413,813 (GRCm39) S784G probably benign Het
Cd300ld2 C T 11: 114,903,118 (GRCm39) probably null Het
Cgn G A 3: 94,686,621 (GRCm39) A227V probably benign Het
Clcn7 G T 17: 25,374,471 (GRCm39) R524L probably damaging Het
Cldn22 G A 8: 48,277,786 (GRCm39) A75T probably benign Het
Ddb1 A G 19: 10,585,724 (GRCm39) D146G probably benign Het
Dhx32 C A 7: 133,324,857 (GRCm39) E607* probably null Het
Egfem1 A G 3: 29,716,580 (GRCm39) Y350C probably damaging Het
Eri2 T A 7: 119,386,976 (GRCm39) D181V probably damaging Het
Gabrg2 T C 11: 41,862,673 (GRCm39) N137S probably damaging Het
Gar1 C T 3: 129,620,497 (GRCm39) G197S unknown Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Hap1 T A 11: 100,246,696 (GRCm39) I70F probably benign Het
Hars2 A G 18: 36,920,607 (GRCm39) Y150C probably damaging Het
Igsf9b G A 9: 27,220,810 (GRCm39) V59I probably damaging Het
Il15 T G 8: 83,058,608 (GRCm39) K142Q probably damaging Het
Klhl23 T C 2: 69,654,804 (GRCm39) Y225H possibly damaging Het
Krt6b T A 15: 101,588,226 (GRCm39) I145F probably benign Het
Lgals3bp T A 11: 118,284,083 (GRCm39) T499S probably benign Het
Lrriq4 A G 3: 30,714,077 (GRCm39) N490S probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Mical3 A G 6: 120,935,238 (GRCm39) S1763P probably damaging Het
Ncoa6 A G 2: 155,250,304 (GRCm39) V1000A probably damaging Het
Nefm A G 14: 68,358,793 (GRCm39) S414P probably benign Het
Or6c76 T C 10: 129,612,581 (GRCm39) V281A probably benign Het
Or6d14 T C 6: 116,534,016 (GRCm39) V210A possibly damaging Het
Pde4dip T C 3: 97,603,287 (GRCm39) D2234G probably damaging Het
Pde6c A T 19: 38,157,887 (GRCm39) Y637F probably benign Het
Pigg T A 5: 108,467,800 (GRCm39) C266* probably null Het
Pkdrej A T 15: 85,702,497 (GRCm39) D1146E possibly damaging Het
Pkp2 T C 16: 16,087,584 (GRCm39) V756A probably benign Het
Pole C T 5: 110,484,909 (GRCm39) T2245I probably benign Het
Ppm1g A C 5: 31,360,914 (GRCm39) probably null Het
Ppp1r36 A G 12: 76,485,298 (GRCm39) I340M possibly damaging Het
Pvr G A 7: 19,643,121 (GRCm39) R371* probably null Het
Rassf9 G A 10: 102,348,369 (GRCm39) probably benign Het
Rtl1 A C 12: 109,559,882 (GRCm39) N652K possibly damaging Het
Sall4 G C 2: 168,592,160 (GRCm39) S998C probably damaging Het
Sdk1 T C 5: 142,197,796 (GRCm39) Y2150H probably damaging Het
Serpinb3b A T 1: 107,083,669 (GRCm39) I170K probably benign Het
Shank2 A T 7: 143,682,137 (GRCm39) D390V probably damaging Het
Slc39a4 A G 15: 76,500,930 (GRCm39) V11A probably benign Het
Synj2 C T 17: 6,040,584 (GRCm39) T220I probably benign Het
Taar7a A G 10: 23,868,733 (GRCm39) I216T probably benign Het
Tas2r122 G T 6: 132,688,634 (GRCm39) D86E probably benign Het
Tbxa2r T A 10: 81,169,018 (GRCm39) C236S probably benign Het
Trav13d-4 C A 14: 53,995,286 (GRCm39) T80K probably benign Het
Trav6d-5 T A 14: 53,033,077 (GRCm39) C109S probably damaging Het
Trio A G 15: 27,847,495 (GRCm39) M982T probably benign Het
Unc80 A T 1: 66,683,485 (GRCm39) T2176S possibly damaging Het
Ypel1 T C 16: 16,910,890 (GRCm39) T259A probably damaging Het
Zfp120 A T 2: 149,959,197 (GRCm39) I397K probably benign Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30,181,976 (GRCm39) missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30,160,164 (GRCm39) unclassified probably benign
IGL00976:Nphs1 APN 7 30,160,110 (GRCm39) missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30,186,089 (GRCm39) missense probably benign 0.01
IGL01465:Nphs1 APN 7 30,186,139 (GRCm39) makesense probably null
IGL01889:Nphs1 APN 7 30,159,936 (GRCm39) missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30,181,060 (GRCm39) splice site probably benign
R0020:Nphs1 UTSW 7 30,162,633 (GRCm39) missense probably benign 0.01
R0485:Nphs1 UTSW 7 30,166,940 (GRCm39) missense probably benign
R1024:Nphs1 UTSW 7 30,173,702 (GRCm39) missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30,180,803 (GRCm39) splice site probably benign
R1144:Nphs1 UTSW 7 30,181,103 (GRCm39) splice site probably benign
R1289:Nphs1 UTSW 7 30,170,603 (GRCm39) missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30,181,256 (GRCm39) splice site probably benign
R1617:Nphs1 UTSW 7 30,181,956 (GRCm39) missense probably benign
R1756:Nphs1 UTSW 7 30,160,959 (GRCm39) missense probably benign 0.00
R1937:Nphs1 UTSW 7 30,173,798 (GRCm39) missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30,160,395 (GRCm39) missense probably benign 0.13
R2256:Nphs1 UTSW 7 30,167,417 (GRCm39) missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30,167,417 (GRCm39) missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30,166,989 (GRCm39) nonsense probably null
R3104:Nphs1 UTSW 7 30,166,965 (GRCm39) nonsense probably null
R3106:Nphs1 UTSW 7 30,166,965 (GRCm39) nonsense probably null
R3151:Nphs1 UTSW 7 30,159,665 (GRCm39) missense probably benign
R3765:Nphs1 UTSW 7 30,170,635 (GRCm39) missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30,166,945 (GRCm39) nonsense probably null
R4397:Nphs1 UTSW 7 30,181,390 (GRCm39) splice site probably null
R4635:Nphs1 UTSW 7 30,167,432 (GRCm39) missense probably benign 0.39
R4650:Nphs1 UTSW 7 30,181,895 (GRCm39) missense probably benign 0.21
R4811:Nphs1 UTSW 7 30,159,854 (GRCm39) missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30,162,657 (GRCm39) missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30,181,067 (GRCm39) missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30,163,250 (GRCm39) missense probably benign 0.00
R5681:Nphs1 UTSW 7 30,186,050 (GRCm39) missense probably benign 0.00
R5865:Nphs1 UTSW 7 30,173,810 (GRCm39) missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30,165,540 (GRCm39) missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30,165,059 (GRCm39) missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30,167,340 (GRCm39) missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30,173,969 (GRCm39) missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30,162,253 (GRCm39) missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30,181,390 (GRCm39) splice site probably null
R7767:Nphs1 UTSW 7 30,162,733 (GRCm39) missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30,181,478 (GRCm39) missense probably benign 0.02
R8485:Nphs1 UTSW 7 30,165,598 (GRCm39) missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30,163,284 (GRCm39) missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30,162,080 (GRCm39) missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30,162,625 (GRCm39) missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30,160,092 (GRCm39) nonsense probably null
R9159:Nphs1 UTSW 7 30,165,026 (GRCm39) missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30,170,594 (GRCm39) missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30,180,875 (GRCm39) missense probably benign 0.00
R9548:Nphs1 UTSW 7 30,180,875 (GRCm39) missense probably benign 0.00
R9607:Nphs1 UTSW 7 30,163,012 (GRCm39) missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30,166,991 (GRCm39) missense probably benign 0.16
R9733:Nphs1 UTSW 7 30,166,955 (GRCm39) missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30,166,929 (GRCm39) missense probably null 0.01
Z1177:Nphs1 UTSW 7 30,170,328 (GRCm39) missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30,159,775 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAACCCTCCAGTTAACTTG -3'
(R):5'- TGAAGACTCCAGTAGCTGCC -3'

Sequencing Primer
(F):5'- TTATAGGAAACCCTATCCCGTCCATG -3'
(R):5'- TCCAGTAGCTGCCGTCTACAG -3'
Posted On 2022-10-06