Incidental Mutation 'R9720:Nphs1'
ID 730718
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9720 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30458315-30487223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30466074 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 622 (V622A)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect possibly damaging
Transcript: ENSMUST00000006825
AA Change: V622A

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: V622A

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126297
AA Change: V608A

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: V608A

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,263,357 V968G probably damaging Het
Adam33 A G 2: 131,058,316 V110A Het
Adamts2 T C 11: 50,776,127 M417T probably damaging Het
Adgrv1 A G 13: 81,592,574 I145T probably damaging Het
Ampd3 C A 7: 110,777,849 H16N probably benign Het
Ank3 A T 10: 69,989,505 S1335C Het
Ankrd26 G A 6: 118,521,941 S1208L probably damaging Het
Atmin G A 8: 116,954,914 probably null Het
AU018091 T C 7: 3,159,432 T323A probably benign Het
Barx2 A G 9: 31,854,111 probably null Het
Brpf3 A G 17: 28,807,356 I468V probably benign Het
Cacna1g T A 11: 94,411,471 H1985L probably benign Het
Cass4 T C 2: 172,427,648 V550A probably benign Het
Ccdc88a A G 11: 29,463,813 S784G probably benign Het
Cd300ld2 C T 11: 115,012,292 probably null Het
Cgn G A 3: 94,779,311 A227V probably benign Het
Clcn7 G T 17: 25,155,497 R524L probably damaging Het
Cldn22 G A 8: 47,824,751 A75T probably benign Het
Ddb1 A G 19: 10,608,360 D146G probably benign Het
Dhx32 C A 7: 133,723,128 E607* probably null Het
Egfem1 A G 3: 29,662,431 Y350C probably damaging Het
Eri2 T A 7: 119,787,753 D181V probably damaging Het
Gabrg2 T C 11: 41,971,846 N137S probably damaging Het
Gar1 C T 3: 129,826,848 G197S unknown Het
Ggta1 G T 2: 35,413,406 D91E probably benign Het
Hap1 T A 11: 100,355,870 I70F probably benign Het
Hars2 A G 18: 36,787,554 Y150C probably damaging Het
Igsf9b G A 9: 27,309,514 V59I probably damaging Het
Il15 T G 8: 82,331,979 K142Q probably damaging Het
Klhl23 T C 2: 69,824,460 Y225H possibly damaging Het
Krt6b T A 15: 101,679,791 I145F probably benign Het
Lgals3bp T A 11: 118,393,257 T499S probably benign Het
Lrriq4 A G 3: 30,659,928 N490S probably damaging Het
Ltbr G A 6: 125,307,385 R365W probably damaging Het
Mical3 A G 6: 120,958,277 S1763P probably damaging Het
Ncoa6 A G 2: 155,408,384 V1000A probably damaging Het
Nefm A G 14: 68,121,344 S414P probably benign Het
Olfr214 T C 6: 116,557,055 V210A possibly damaging Het
Olfr809 T C 10: 129,776,712 V281A probably benign Het
Pde4dip T C 3: 97,695,971 D2234G probably damaging Het
Pde6c A T 19: 38,169,439 Y637F probably benign Het
Pigg T A 5: 108,319,934 C266* probably null Het
Pkdrej A T 15: 85,818,296 D1146E possibly damaging Het
Pkp2 T C 16: 16,269,720 V756A probably benign Het
Pole C T 5: 110,337,043 T2245I probably benign Het
Ppil2 T C 16: 17,093,026 T259A probably damaging Het
Ppm1g A C 5: 31,203,570 probably null Het
Ppp1r36 A G 12: 76,438,524 I340M possibly damaging Het
Pvr G A 7: 19,909,196 R371* probably null Het
Rassf9 G A 10: 102,512,508 probably benign Het
Rtl1 A C 12: 109,593,448 N652K possibly damaging Het
Sall4 G C 2: 168,750,240 S998C probably damaging Het
Sdk1 T C 5: 142,212,041 Y2150H probably damaging Het
Serpinb3b A T 1: 107,155,939 I170K probably benign Het
Shank2 A T 7: 144,128,400 D390V probably damaging Het
Slc39a4 A G 15: 76,616,730 V11A probably benign Het
Synj2 C T 17: 5,990,309 T220I probably benign Het
Taar7a A G 10: 23,992,835 I216T probably benign Het
Tas2r122 G T 6: 132,711,671 D86E probably benign Het
Tbxa2r T A 10: 81,333,184 C236S probably benign Het
Trav13-4-dv7 C A 14: 53,757,829 T80K probably benign Het
Trav6d-5 T A 14: 52,795,620 C109S probably damaging Het
Trio A G 15: 27,847,409 M982T probably benign Het
Uhrf1bp1l T A 10: 89,805,357 S797T probably benign Het
Unc80 A T 1: 66,644,326 T2176S possibly damaging Het
Zfp120 A T 2: 150,117,277 I397K probably benign Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30482053 missense probably benign 0.02
R8485:Nphs1 UTSW 7 30466173 missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30463859 missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30462655 missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30463200 missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30460667 nonsense probably null
R9159:Nphs1 UTSW 7 30465601 missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30471169 missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9548:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9607:Nphs1 UTSW 7 30463587 missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30467566 missense probably benign 0.16
R9733:Nphs1 UTSW 7 30467530 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30460350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAACCCTCCAGTTAACTTG -3'
(R):5'- TGAAGACTCCAGTAGCTGCC -3'

Sequencing Primer
(F):5'- TTATAGGAAACCCTATCCCGTCCATG -3'
(R):5'- TCCAGTAGCTGCCGTCTACAG -3'
Posted On 2022-10-06