Incidental Mutation 'R9720:Acaca'
ID 730737
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Name acetyl-Coenzyme A carboxylase alpha
Synonyms Acc1, LOC327983, Acac, acetyl-CoA carboxylase, A530025K05Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9720 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84020498-84292477 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 84154183 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 968 (V968G)
Ref Sequence ENSEMBL: ENSMUSP00000020843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201]
AlphaFold Q5SWU9
Predicted Effect probably damaging
Transcript: ENSMUST00000020843
AA Change: V968G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: V968G

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103201
AA Change: V968G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: V968G

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 A G 2: 130,900,236 (GRCm39) V110A Het
Adamts2 T C 11: 50,666,954 (GRCm39) M417T probably damaging Het
Adgrv1 A G 13: 81,740,693 (GRCm39) I145T probably damaging Het
Ampd3 C A 7: 110,377,056 (GRCm39) H16N probably benign Het
Ank3 A T 10: 69,825,335 (GRCm39) S1335C Het
Ankrd26 G A 6: 118,498,902 (GRCm39) S1208L probably damaging Het
Atmin G A 8: 117,681,653 (GRCm39) probably null Het
AU018091 T C 7: 3,209,272 (GRCm39) T323A probably benign Het
Barx2 A G 9: 31,765,407 (GRCm39) probably null Het
Bltp3b T A 10: 89,641,219 (GRCm39) S797T probably benign Het
Brpf3 A G 17: 29,026,330 (GRCm39) I468V probably benign Het
Cacna1g T A 11: 94,302,297 (GRCm39) H1985L probably benign Het
Cass4 T C 2: 172,269,568 (GRCm39) V550A probably benign Het
Ccdc88a A G 11: 29,413,813 (GRCm39) S784G probably benign Het
Cd300ld2 C T 11: 114,903,118 (GRCm39) probably null Het
Cgn G A 3: 94,686,621 (GRCm39) A227V probably benign Het
Clcn7 G T 17: 25,374,471 (GRCm39) R524L probably damaging Het
Cldn22 G A 8: 48,277,786 (GRCm39) A75T probably benign Het
Ddb1 A G 19: 10,585,724 (GRCm39) D146G probably benign Het
Dhx32 C A 7: 133,324,857 (GRCm39) E607* probably null Het
Egfem1 A G 3: 29,716,580 (GRCm39) Y350C probably damaging Het
Eri2 T A 7: 119,386,976 (GRCm39) D181V probably damaging Het
Gabrg2 T C 11: 41,862,673 (GRCm39) N137S probably damaging Het
Gar1 C T 3: 129,620,497 (GRCm39) G197S unknown Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Hap1 T A 11: 100,246,696 (GRCm39) I70F probably benign Het
Hars2 A G 18: 36,920,607 (GRCm39) Y150C probably damaging Het
Igsf9b G A 9: 27,220,810 (GRCm39) V59I probably damaging Het
Il15 T G 8: 83,058,608 (GRCm39) K142Q probably damaging Het
Klhl23 T C 2: 69,654,804 (GRCm39) Y225H possibly damaging Het
Krt6b T A 15: 101,588,226 (GRCm39) I145F probably benign Het
Lgals3bp T A 11: 118,284,083 (GRCm39) T499S probably benign Het
Lrriq4 A G 3: 30,714,077 (GRCm39) N490S probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Mical3 A G 6: 120,935,238 (GRCm39) S1763P probably damaging Het
Ncoa6 A G 2: 155,250,304 (GRCm39) V1000A probably damaging Het
Nefm A G 14: 68,358,793 (GRCm39) S414P probably benign Het
Nphs1 T C 7: 30,165,499 (GRCm39) V622A possibly damaging Het
Or6c76 T C 10: 129,612,581 (GRCm39) V281A probably benign Het
Or6d14 T C 6: 116,534,016 (GRCm39) V210A possibly damaging Het
Pde4dip T C 3: 97,603,287 (GRCm39) D2234G probably damaging Het
Pde6c A T 19: 38,157,887 (GRCm39) Y637F probably benign Het
Pigg T A 5: 108,467,800 (GRCm39) C266* probably null Het
Pkdrej A T 15: 85,702,497 (GRCm39) D1146E possibly damaging Het
Pkp2 T C 16: 16,087,584 (GRCm39) V756A probably benign Het
Pole C T 5: 110,484,909 (GRCm39) T2245I probably benign Het
Ppm1g A C 5: 31,360,914 (GRCm39) probably null Het
Ppp1r36 A G 12: 76,485,298 (GRCm39) I340M possibly damaging Het
Pvr G A 7: 19,643,121 (GRCm39) R371* probably null Het
Rassf9 G A 10: 102,348,369 (GRCm39) probably benign Het
Rtl1 A C 12: 109,559,882 (GRCm39) N652K possibly damaging Het
Sall4 G C 2: 168,592,160 (GRCm39) S998C probably damaging Het
Sdk1 T C 5: 142,197,796 (GRCm39) Y2150H probably damaging Het
Serpinb3b A T 1: 107,083,669 (GRCm39) I170K probably benign Het
Shank2 A T 7: 143,682,137 (GRCm39) D390V probably damaging Het
Slc39a4 A G 15: 76,500,930 (GRCm39) V11A probably benign Het
Synj2 C T 17: 6,040,584 (GRCm39) T220I probably benign Het
Taar7a A G 10: 23,868,733 (GRCm39) I216T probably benign Het
Tas2r122 G T 6: 132,688,634 (GRCm39) D86E probably benign Het
Tbxa2r T A 10: 81,169,018 (GRCm39) C236S probably benign Het
Trav13d-4 C A 14: 53,995,286 (GRCm39) T80K probably benign Het
Trav6d-5 T A 14: 53,033,077 (GRCm39) C109S probably damaging Het
Trio A G 15: 27,847,495 (GRCm39) M982T probably benign Het
Unc80 A T 1: 66,683,485 (GRCm39) T2176S possibly damaging Het
Ypel1 T C 16: 16,910,890 (GRCm39) T259A probably damaging Het
Zfp120 A T 2: 149,959,197 (GRCm39) I397K probably benign Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84,169,743 (GRCm39) missense probably damaging 1.00
IGL01134:Acaca APN 11 84,142,105 (GRCm39) missense probably benign 0.22
IGL01446:Acaca APN 11 84,151,457 (GRCm39) missense probably damaging 1.00
IGL01591:Acaca APN 11 84,134,146 (GRCm39) missense probably damaging 1.00
IGL01663:Acaca APN 11 84,168,628 (GRCm39) missense possibly damaging 0.85
IGL01767:Acaca APN 11 84,211,368 (GRCm39) missense probably benign 0.01
IGL02206:Acaca APN 11 84,151,573 (GRCm39) nonsense probably null
IGL02335:Acaca APN 11 84,105,084 (GRCm39) missense possibly damaging 0.84
IGL02477:Acaca APN 11 84,197,994 (GRCm39) splice site probably benign
IGL02515:Acaca APN 11 84,153,229 (GRCm39) missense probably benign
IGL02651:Acaca APN 11 84,136,030 (GRCm39) splice site probably benign
IGL02805:Acaca APN 11 84,113,959 (GRCm39) splice site probably benign
IGL03328:Acaca APN 11 84,211,355 (GRCm39) missense probably benign 0.00
effervescence UTSW 11 84,153,300 (GRCm39) missense probably benign 0.41
fizz UTSW 11 84,136,682 (GRCm39) missense probably damaging 0.98
greenhouse UTSW 11 84,229,182 (GRCm39) missense probably damaging 1.00
Serene UTSW 11 84,202,235 (GRCm39) splice site probably null
Tranquil UTSW 11 84,171,287 (GRCm39) missense probably damaging 1.00
vitamin UTSW 11 84,171,261 (GRCm39) missense possibly damaging 0.78
ANU05:Acaca UTSW 11 84,206,678 (GRCm39) missense probably damaging 1.00
R0385:Acaca UTSW 11 84,122,574 (GRCm39) missense probably benign 0.01
R0518:Acaca UTSW 11 84,181,112 (GRCm39) critical splice acceptor site probably null
R0536:Acaca UTSW 11 84,171,342 (GRCm39) splice site probably benign
R0962:Acaca UTSW 11 84,202,129 (GRCm39) missense probably damaging 1.00
R0968:Acaca UTSW 11 84,129,859 (GRCm39) nonsense probably null
R1123:Acaca UTSW 11 84,154,906 (GRCm39) missense probably benign 0.09
R1452:Acaca UTSW 11 84,185,885 (GRCm39) splice site probably benign
R1478:Acaca UTSW 11 84,263,453 (GRCm39) missense probably damaging 1.00
R1500:Acaca UTSW 11 84,184,810 (GRCm39) missense probably benign 0.00
R1512:Acaca UTSW 11 84,086,295 (GRCm39) missense probably benign 0.00
R1657:Acaca UTSW 11 84,154,910 (GRCm39) missense probably benign 0.09
R1681:Acaca UTSW 11 84,117,011 (GRCm39) missense probably damaging 1.00
R1682:Acaca UTSW 11 84,283,043 (GRCm39) missense probably benign 0.23
R1688:Acaca UTSW 11 84,129,722 (GRCm39) missense probably damaging 1.00
R1755:Acaca UTSW 11 84,167,390 (GRCm39) frame shift probably null
R1775:Acaca UTSW 11 84,191,248 (GRCm39) missense possibly damaging 0.56
R1793:Acaca UTSW 11 84,229,219 (GRCm39) missense probably damaging 1.00
R1793:Acaca UTSW 11 84,206,795 (GRCm39) missense probably damaging 0.98
R1855:Acaca UTSW 11 84,262,380 (GRCm39) missense probably damaging 0.96
R1881:Acaca UTSW 11 84,191,297 (GRCm39) splice site probably benign
R1881:Acaca UTSW 11 84,161,213 (GRCm39) nonsense probably null
R1989:Acaca UTSW 11 84,153,355 (GRCm39) missense probably damaging 0.98
R2147:Acaca UTSW 11 84,167,362 (GRCm39) missense probably benign 0.03
R2215:Acaca UTSW 11 84,254,619 (GRCm39) missense probably damaging 1.00
R2238:Acaca UTSW 11 84,282,331 (GRCm39) splice site probably benign
R2252:Acaca UTSW 11 84,262,358 (GRCm39) missense probably damaging 0.99
R2316:Acaca UTSW 11 84,185,809 (GRCm39) missense possibly damaging 0.69
R2316:Acaca UTSW 11 84,154,906 (GRCm39) missense probably benign 0.16
R2337:Acaca UTSW 11 84,148,023 (GRCm39) missense possibly damaging 0.93
R2697:Acaca UTSW 11 84,255,239 (GRCm39) missense probably damaging 1.00
R3551:Acaca UTSW 11 84,152,450 (GRCm39) missense probably damaging 1.00
R3552:Acaca UTSW 11 84,152,450 (GRCm39) missense probably damaging 1.00
R3748:Acaca UTSW 11 84,202,235 (GRCm39) splice site probably null
R3844:Acaca UTSW 11 84,255,239 (GRCm39) missense probably damaging 1.00
R3873:Acaca UTSW 11 84,203,547 (GRCm39) unclassified probably benign
R4152:Acaca UTSW 11 84,183,752 (GRCm39) missense possibly damaging 0.88
R4406:Acaca UTSW 11 84,171,275 (GRCm39) missense probably benign 0.35
R4448:Acaca UTSW 11 84,153,318 (GRCm39) missense probably damaging 1.00
R4642:Acaca UTSW 11 84,171,287 (GRCm39) missense probably damaging 1.00
R4696:Acaca UTSW 11 84,171,261 (GRCm39) missense possibly damaging 0.78
R4707:Acaca UTSW 11 84,203,680 (GRCm39) missense probably damaging 0.96
R4710:Acaca UTSW 11 84,283,163 (GRCm39) missense possibly damaging 0.84
R4775:Acaca UTSW 11 84,134,165 (GRCm39) missense probably damaging 1.00
R4821:Acaca UTSW 11 84,185,813 (GRCm39) missense possibly damaging 0.69
R4883:Acaca UTSW 11 84,142,116 (GRCm39) missense probably benign 0.01
R4988:Acaca UTSW 11 84,154,121 (GRCm39) missense probably damaging 1.00
R5034:Acaca UTSW 11 84,136,090 (GRCm39) missense probably benign 0.00
R5255:Acaca UTSW 11 84,202,133 (GRCm39) missense probably damaging 1.00
R5294:Acaca UTSW 11 84,282,345 (GRCm39) missense probably benign 0.01
R5350:Acaca UTSW 11 84,106,699 (GRCm39) missense probably damaging 0.99
R5437:Acaca UTSW 11 84,237,646 (GRCm39) splice site probably null
R5664:Acaca UTSW 11 84,134,210 (GRCm39) missense probably damaging 1.00
R5665:Acaca UTSW 11 84,136,120 (GRCm39) nonsense probably null
R5959:Acaca UTSW 11 84,106,792 (GRCm39) missense probably damaging 1.00
R6011:Acaca UTSW 11 84,136,570 (GRCm39) missense probably benign 0.44
R6027:Acaca UTSW 11 84,289,003 (GRCm39) missense probably benign
R6246:Acaca UTSW 11 84,206,796 (GRCm39) missense probably benign 0.08
R6313:Acaca UTSW 11 84,183,755 (GRCm39) missense probably benign 0.00
R6450:Acaca UTSW 11 84,171,294 (GRCm39) missense probably damaging 0.98
R6623:Acaca UTSW 11 84,262,325 (GRCm39) critical splice acceptor site probably null
R6736:Acaca UTSW 11 84,129,664 (GRCm39) missense probably benign 0.05
R6752:Acaca UTSW 11 84,086,309 (GRCm39) missense probably benign 0.44
R6807:Acaca UTSW 11 84,282,356 (GRCm39) missense probably benign
R6826:Acaca UTSW 11 84,086,362 (GRCm39) missense probably damaging 1.00
R7035:Acaca UTSW 11 84,129,769 (GRCm39) missense probably damaging 1.00
R7078:Acaca UTSW 11 84,154,138 (GRCm39) missense possibly damaging 0.91
R7088:Acaca UTSW 11 84,169,783 (GRCm39) critical splice donor site probably null
R7201:Acaca UTSW 11 84,153,300 (GRCm39) missense probably benign 0.41
R7261:Acaca UTSW 11 84,259,526 (GRCm39) missense probably damaging 1.00
R7399:Acaca UTSW 11 84,151,505 (GRCm39) missense possibly damaging 0.89
R7421:Acaca UTSW 11 84,254,562 (GRCm39) missense possibly damaging 0.64
R7443:Acaca UTSW 11 84,206,619 (GRCm39) missense probably benign 0.02
R7453:Acaca UTSW 11 84,136,136 (GRCm39) missense probably benign
R7471:Acaca UTSW 11 84,168,608 (GRCm39) splice site probably null
R7519:Acaca UTSW 11 84,136,682 (GRCm39) missense probably damaging 0.98
R7537:Acaca UTSW 11 84,151,460 (GRCm39) missense probably damaging 1.00
R7574:Acaca UTSW 11 84,152,414 (GRCm39) missense probably benign
R7633:Acaca UTSW 11 84,263,465 (GRCm39) missense probably benign 0.26
R7643:Acaca UTSW 11 84,229,182 (GRCm39) missense probably damaging 1.00
R7664:Acaca UTSW 11 84,136,175 (GRCm39) missense probably damaging 1.00
R7675:Acaca UTSW 11 84,206,742 (GRCm39) missense probably benign 0.04
R7676:Acaca UTSW 11 84,185,813 (GRCm39) missense possibly damaging 0.69
R7729:Acaca UTSW 11 84,262,339 (GRCm39) missense probably damaging 0.98
R7867:Acaca UTSW 11 84,140,350 (GRCm39) missense possibly damaging 0.88
R7898:Acaca UTSW 11 84,255,275 (GRCm39) critical splice donor site probably null
R7909:Acaca UTSW 11 84,136,061 (GRCm39) missense possibly damaging 0.56
R7915:Acaca UTSW 11 84,167,414 (GRCm39) missense probably benign
R7956:Acaca UTSW 11 84,211,406 (GRCm39) missense probably damaging 0.98
R8000:Acaca UTSW 11 84,283,057 (GRCm39) missense possibly damaging 0.88
R8038:Acaca UTSW 11 84,106,730 (GRCm39) missense probably damaging 1.00
R8545:Acaca UTSW 11 84,236,794 (GRCm39) missense probably damaging 1.00
R8722:Acaca UTSW 11 84,229,283 (GRCm39) missense possibly damaging 0.85
R9005:Acaca UTSW 11 84,262,410 (GRCm39) missense probably damaging 0.99
R9130:Acaca UTSW 11 84,202,145 (GRCm39) missense probably damaging 1.00
R9397:Acaca UTSW 11 84,259,551 (GRCm39) missense probably damaging 1.00
R9489:Acaca UTSW 11 84,183,842 (GRCm39) missense probably benign 0.01
R9540:Acaca UTSW 11 84,134,237 (GRCm39) missense probably damaging 1.00
R9593:Acaca UTSW 11 84,271,339 (GRCm39) nonsense probably null
R9605:Acaca UTSW 11 84,183,842 (GRCm39) missense probably benign 0.01
R9634:Acaca UTSW 11 84,184,816 (GRCm39) missense probably benign 0.00
RF014:Acaca UTSW 11 84,122,550 (GRCm39) missense probably benign 0.01
X0027:Acaca UTSW 11 84,183,721 (GRCm39) missense probably benign 0.01
X0060:Acaca UTSW 11 84,154,930 (GRCm39) missense probably benign
X0067:Acaca UTSW 11 84,259,563 (GRCm39) nonsense probably null
Z1176:Acaca UTSW 11 84,151,546 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGAGACTCTTTGGTAGTG -3'
(R):5'- ATTTTGGGGCCATAATAACTGACAG -3'

Sequencing Primer
(F):5'- AGACTCTTTGGTAGTGGTGCTGATG -3'
(R):5'- GGGCCATAATAACTGACAGAGTATC -3'
Posted On 2022-10-06