Incidental Mutation 'R9721:Cfap65'
ID 730763
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74902071-74935599 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74919342 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 869 (T869A)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: T869A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: T869A

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,419,283 Y120N probably benign Het
2410089E03Rik A G 15: 8,225,409 T27A unknown Het
4931428F04Rik A T 8: 105,283,188 D376E probably benign Het
AI314180 A T 4: 58,850,938 S412T probably benign Het
Alox8 T A 11: 69,197,085 H131L probably benign Het
Atp13a1 A G 8: 69,799,437 E588G probably damaging Het
AU040320 G A 4: 126,839,648 V654M probably damaging Het
Bicra A G 7: 15,979,176 L982P probably damaging Het
Cdh11 A T 8: 102,679,625 V72E probably damaging Het
Ddx19a A G 8: 110,978,475 F338S probably damaging Het
Dhrs7c T A 11: 67,815,078 V219E probably damaging Het
Dhx33 A G 11: 71,001,598 V115A probably damaging Het
Dst A G 1: 34,192,785 D3153G probably benign Het
Eif5b T C 1: 38,037,659 probably null Het
Ep300 A G 15: 81,608,315 N284S unknown Het
Fam83a A G 15: 57,986,117 N19S probably benign Het
Fgd5 A T 6: 91,988,297 T504S probably benign Het
Flt4 G A 11: 49,644,433 probably null Het
Ggta1 G T 2: 35,413,406 D91E probably benign Het
Gls A G 1: 52,212,268 V310A probably damaging Het
Gm13178 A T 4: 144,703,372 V349D possibly damaging Het
Gm5414 A T 15: 101,628,147 C14* probably null Het
Gm906 T C 13: 50,246,652 Y546C possibly damaging Het
Gm9887 C G 12: 69,371,855 A202P unknown Het
Ifi214 T C 1: 173,527,913 T110A possibly damaging Het
Il4i1 A G 7: 44,839,689 R293G probably benign Het
Itpr1 A T 6: 108,406,102 T1464S probably damaging Het
Kif18a T C 2: 109,293,055 S225P probably damaging Het
Kif21a A T 15: 90,971,127 I678N probably damaging Het
Klf11 T A 12: 24,660,241 D429E probably damaging Het
Kntc1 A G 5: 123,801,885 T1581A probably benign Het
Lama2 T C 10: 27,467,342 N45D possibly damaging Het
Lrrk1 T C 7: 66,274,875 I1319V probably damaging Het
Ltbr G A 6: 125,307,385 R365W probably damaging Het
Malrd1 C T 2: 15,696,827 T751I unknown Het
Mgat5b T C 11: 116,966,769 L363P probably damaging Het
Mphosph9 A T 5: 124,298,675 S535R possibly damaging Het
Nckap5 C T 1: 126,027,280 D512N probably damaging Het
Ngef T A 1: 87,479,135 D637V probably damaging Het
Nup93 T C 8: 94,303,685 Y391H probably damaging Het
Olfr1215 T C 2: 89,001,716 T191A Het
Olfr1406 C A 1: 173,184,348 V29F probably benign Het
Olfr1469 A T 19: 13,410,970 T134S probably benign Het
Pcdhb4 C A 18: 37,309,852 D738E possibly damaging Het
Pfpl G C 19: 12,428,933 E183Q probably damaging Het
Phactr3 G A 2: 178,256,250 E86K probably damaging Het
Psd C T 19: 46,323,189 D351N probably benign Het
Pzp A G 6: 128,495,191 probably null Het
Rerg T A 6: 137,056,417 K106* probably null Het
Samd9l T C 6: 3,375,854 E469G possibly damaging Het
Smok2b C A 17: 13,234,978 Y8* probably null Het
Spn A G 7: 127,136,265 S357P probably benign Het
Tek T G 4: 94,804,302 W216G possibly damaging Het
Trpm3 A T 19: 22,889,398 H531L probably benign Het
Trpm6 A G 19: 18,829,972 M1027V probably benign Het
Tsc2 G A 17: 24,599,642 R1408* probably null Het
Unc13b A G 4: 43,101,869 N155D probably benign Het
Vmn1r52 G A 6: 90,179,026 C104Y probably damaging Het
Xylt1 A T 7: 117,549,020 E273V probably damaging Het
Zc3h4 C A 7: 16,434,845 Q1035K unknown Het
Zcchc11 T A 4: 108,555,581 M1493K probably benign Het
Zfp14 A T 7: 30,039,184 S125R probably benign Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74903223 missense probably benign 0.43
R8996:Cfap65 UTSW 1 74902188 missense probably benign 0.11
R9020:Cfap65 UTSW 1 74920393 missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74904688 missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74919351 splice site probably benign
R9187:Cfap65 UTSW 1 74917358 missense probably benign 0.00
R9210:Cfap65 UTSW 1 74920408 missense probably benign
R9212:Cfap65 UTSW 1 74920408 missense probably benign
R9273:Cfap65 UTSW 1 74921610 missense probably benign 0.00
R9454:Cfap65 UTSW 1 74905051 missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74906309 critical splice donor site probably null
R9595:Cfap65 UTSW 1 74907378 missense probably damaging 1.00
R9742:Cfap65 UTSW 1 74904681 missense probably benign 0.08
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACAGGGCTTCTACTCACAG -3'
(R):5'- CTGAGGCTCCAGTTTCCATC -3'

Sequencing Primer
(F):5'- TCACAGAGAGGCATCCAGTAAC -3'
(R):5'- GAGGCTCCAGTTTCCATCATAATGAG -3'
Posted On 2022-10-06