Incidental Mutation 'R9721:Kif18a'
ID 730771
Institutional Source Beutler Lab
Gene Symbol Kif18a
Ensembl Gene ENSMUSG00000027115
Gene Name kinesin family member 18A
Synonyms gcd2, N-8 kinesin, B130001M12Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 109111165-109172094 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 109123400 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 225 (S225P)
Ref Sequence ENSEMBL: ENSMUSP00000028527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028527]
AlphaFold Q91WD7
Predicted Effect probably damaging
Transcript: ENSMUST00000028527
AA Change: S225P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028527
Gene: ENSMUSG00000027115
AA Change: S225P

DomainStartEndE-ValueType
KISc 9 363 8.91e-158 SMART
Blast:KISc 382 433 1e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KIF18A is a member of the kinesin superfamily of microtubule-associated molecular motors (see MIM 148760) that use hydrolysis of ATP to produce force and movement along microtubules (Luboshits and Benayahu, 2005 [PubMed 15878648]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for loss of function alleles exhibit reduced female fertility and male infertility due to primordial germ cell depletion. The sterility phenotype is incompletely penetrant, has variable expressivity, and is modulated by strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,212,932 (GRCm39) Y120N probably benign Het
AAdacl4fm3 A T 4: 144,429,942 (GRCm39) V349D possibly damaging Het
Alox8 T A 11: 69,087,911 (GRCm39) H131L probably benign Het
Atp13a1 A G 8: 70,252,087 (GRCm39) E588G probably damaging Het
AU040320 G A 4: 126,733,441 (GRCm39) V654M probably damaging Het
Bicra A G 7: 15,713,101 (GRCm39) L982P probably damaging Het
Cdh11 A T 8: 103,406,257 (GRCm39) V72E probably damaging Het
Cfap65 T C 1: 74,958,501 (GRCm39) T869A probably benign Het
Cplane1 A G 15: 8,254,893 (GRCm39) T27A unknown Het
Ddx19a A G 8: 111,705,107 (GRCm39) F338S probably damaging Het
Dhrs7c T A 11: 67,705,904 (GRCm39) V219E probably damaging Het
Dhx33 A G 11: 70,892,424 (GRCm39) V115A probably damaging Het
Dst A G 1: 34,231,866 (GRCm39) D3153G probably benign Het
Ecpas A T 4: 58,850,938 (GRCm39) S412T probably benign Het
Eif5b T C 1: 38,076,740 (GRCm39) probably null Het
Ep300 A G 15: 81,492,516 (GRCm39) N284S unknown Het
Fam83a A G 15: 57,849,513 (GRCm39) N19S probably benign Het
Fgd5 A T 6: 91,965,278 (GRCm39) T504S probably benign Het
Flt4 G A 11: 49,535,260 (GRCm39) probably null Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Gls A G 1: 52,251,427 (GRCm39) V310A probably damaging Het
Gm5414 A T 15: 101,536,582 (GRCm39) C14* probably null Het
Gm9887 C G 12: 69,418,629 (GRCm39) A202P unknown Het
Ifi214 T C 1: 173,355,479 (GRCm39) T110A possibly damaging Het
Il4i1 A G 7: 44,489,113 (GRCm39) R293G probably benign Het
Itpr1 A T 6: 108,383,063 (GRCm39) T1464S probably damaging Het
Kif21a A T 15: 90,855,330 (GRCm39) I678N probably damaging Het
Klf11 T A 12: 24,710,240 (GRCm39) D429E probably damaging Het
Kntc1 A G 5: 123,939,948 (GRCm39) T1581A probably benign Het
Lama2 T C 10: 27,343,338 (GRCm39) N45D possibly damaging Het
Lrrk1 T C 7: 65,924,623 (GRCm39) I1319V probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Malrd1 C T 2: 15,701,638 (GRCm39) T751I unknown Het
Matcap1 A T 8: 106,009,820 (GRCm39) D376E probably benign Het
Mgat5b T C 11: 116,857,595 (GRCm39) L363P probably damaging Het
Mphosph9 A T 5: 124,436,738 (GRCm39) S535R possibly damaging Het
Nckap5 C T 1: 125,955,017 (GRCm39) D512N probably damaging Het
Ngef T A 1: 87,406,857 (GRCm39) D637V probably damaging Het
Nup93 T C 8: 95,030,313 (GRCm39) Y391H probably damaging Het
Or10j7 C A 1: 173,011,915 (GRCm39) V29F probably benign Het
Or4c110 T C 2: 88,832,060 (GRCm39) T191A Het
Or5b3 A T 19: 13,388,334 (GRCm39) T134S probably benign Het
Pcdhb4 C A 18: 37,442,905 (GRCm39) D738E possibly damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Phactr3 G A 2: 177,898,043 (GRCm39) E86K probably damaging Het
Psd C T 19: 46,311,628 (GRCm39) D351N probably benign Het
Pzp A G 6: 128,472,154 (GRCm39) probably null Het
Rerg T A 6: 137,033,415 (GRCm39) K106* probably null Het
Samd9l T C 6: 3,375,854 (GRCm39) E469G possibly damaging Het
Smok2b C A 17: 13,453,865 (GRCm39) Y8* probably null Het
Spata31e3 T C 13: 50,400,688 (GRCm39) Y546C possibly damaging Het
Spn A G 7: 126,735,437 (GRCm39) S357P probably benign Het
Tek T G 4: 94,692,539 (GRCm39) W216G possibly damaging Het
Trpm3 A T 19: 22,866,762 (GRCm39) H531L probably benign Het
Trpm6 A G 19: 18,807,336 (GRCm39) M1027V probably benign Het
Tsc2 G A 17: 24,818,616 (GRCm39) R1408* probably null Het
Tut4 T A 4: 108,412,778 (GRCm39) M1493K probably benign Het
Unc13b A G 4: 43,101,869 (GRCm39) N155D probably benign Het
Vmn1r52 G A 6: 90,156,008 (GRCm39) C104Y probably damaging Het
Xylt1 A T 7: 117,148,255 (GRCm39) E273V probably damaging Het
Zc3h4 C A 7: 16,168,770 (GRCm39) Q1035K unknown Het
Zfp14 A T 7: 29,738,609 (GRCm39) S125R probably benign Het
Other mutations in Kif18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Kif18a APN 2 109,148,333 (GRCm39) missense possibly damaging 0.93
IGL00795:Kif18a APN 2 109,123,365 (GRCm39) missense probably damaging 1.00
IGL00904:Kif18a APN 2 109,122,471 (GRCm39) missense probably damaging 1.00
IGL00990:Kif18a APN 2 109,164,767 (GRCm39) missense probably benign 0.01
IGL01323:Kif18a APN 2 109,128,787 (GRCm39) missense probably benign 0.02
IGL01382:Kif18a APN 2 109,127,111 (GRCm39) nonsense probably null
IGL02205:Kif18a APN 2 109,137,363 (GRCm39) splice site probably benign
IGL02207:Kif18a APN 2 109,127,052 (GRCm39) missense probably damaging 0.99
IGL02970:Kif18a APN 2 109,118,233 (GRCm39) missense probably damaging 1.00
IGL03087:Kif18a APN 2 109,148,462 (GRCm39) splice site probably benign
R0030:Kif18a UTSW 2 109,163,663 (GRCm39) missense probably benign
R0482:Kif18a UTSW 2 109,118,188 (GRCm39) start codon destroyed probably null 1.00
R0631:Kif18a UTSW 2 109,128,667 (GRCm39) splice site probably benign
R1597:Kif18a UTSW 2 109,123,336 (GRCm39) missense probably damaging 1.00
R1640:Kif18a UTSW 2 109,120,161 (GRCm39) missense probably benign 0.25
R1675:Kif18a UTSW 2 109,128,748 (GRCm39) missense probably benign
R1723:Kif18a UTSW 2 109,133,227 (GRCm39) missense probably damaging 1.00
R2141:Kif18a UTSW 2 109,163,848 (GRCm39) missense probably benign 0.43
R2142:Kif18a UTSW 2 109,163,848 (GRCm39) missense probably benign 0.43
R2243:Kif18a UTSW 2 109,128,452 (GRCm39) missense probably damaging 1.00
R3609:Kif18a UTSW 2 109,168,941 (GRCm39) missense probably benign 0.02
R3611:Kif18a UTSW 2 109,168,941 (GRCm39) missense probably benign 0.02
R3882:Kif18a UTSW 2 109,137,319 (GRCm39) missense probably benign 0.01
R4292:Kif18a UTSW 2 109,128,471 (GRCm39) missense probably damaging 0.99
R4293:Kif18a UTSW 2 109,123,398 (GRCm39) missense probably benign
R4294:Kif18a UTSW 2 109,123,398 (GRCm39) missense probably benign
R4295:Kif18a UTSW 2 109,123,398 (GRCm39) missense probably benign
R4428:Kif18a UTSW 2 109,118,466 (GRCm39) missense probably damaging 1.00
R4791:Kif18a UTSW 2 109,118,220 (GRCm39) missense probably benign 0.16
R4819:Kif18a UTSW 2 109,122,471 (GRCm39) missense probably damaging 1.00
R5078:Kif18a UTSW 2 109,125,487 (GRCm39) splice site probably benign
R5175:Kif18a UTSW 2 109,133,323 (GRCm39) splice site probably null
R5319:Kif18a UTSW 2 109,148,370 (GRCm39) missense probably benign 0.00
R5821:Kif18a UTSW 2 109,120,190 (GRCm39) splice site probably benign
R5966:Kif18a UTSW 2 109,122,411 (GRCm39) missense probably damaging 1.00
R6886:Kif18a UTSW 2 109,127,008 (GRCm39) missense probably damaging 1.00
R7069:Kif18a UTSW 2 109,125,347 (GRCm39) missense probably damaging 0.99
R7765:Kif18a UTSW 2 109,137,285 (GRCm39) missense probably benign 0.00
R7801:Kif18a UTSW 2 109,118,190 (GRCm39) missense probably damaging 0.99
R7834:Kif18a UTSW 2 109,127,119 (GRCm39) missense probably damaging 1.00
R8442:Kif18a UTSW 2 109,125,318 (GRCm39) missense possibly damaging 0.68
R8510:Kif18a UTSW 2 109,127,109 (GRCm39) missense probably damaging 1.00
R8782:Kif18a UTSW 2 109,127,118 (GRCm39) missense probably damaging 1.00
R8936:Kif18a UTSW 2 109,163,966 (GRCm39) missense probably benign 0.00
R9014:Kif18a UTSW 2 109,123,414 (GRCm39) missense probably damaging 1.00
R9135:Kif18a UTSW 2 109,171,506 (GRCm39) missense possibly damaging 0.90
R9246:Kif18a UTSW 2 109,163,819 (GRCm39) missense probably benign
R9483:Kif18a UTSW 2 109,120,032 (GRCm39) missense probably damaging 1.00
R9512:Kif18a UTSW 2 109,171,517 (GRCm39) missense probably benign 0.11
R9644:Kif18a UTSW 2 109,171,517 (GRCm39) missense probably benign 0.11
R9727:Kif18a UTSW 2 109,118,464 (GRCm39) missense probably damaging 1.00
Z1176:Kif18a UTSW 2 109,148,398 (GRCm39) missense possibly damaging 0.63
Z1177:Kif18a UTSW 2 109,125,302 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCATTTGTTCAATAAGCTTACCGA -3'
(R):5'- AACAAAGTTGCGAACGAAGC -3'

Sequencing Primer
(F):5'- TCAATAAGCTTACCGAGGGTCTG -3'
(R):5'- GCAATGGAAGTGCTGAGGAAC -3'
Posted On 2022-10-06