Incidental Mutation 'R9721:Phactr3'
ID 730772
Institutional Source Beutler Lab
Gene Symbol Phactr3
Ensembl Gene ENSMUSG00000027525
Gene Name phosphatase and actin regulator 3
Synonyms 4930415A02Rik, 1500003N10Rik, scapinin
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.102) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 177760768-177980285 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 177898043 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 86 (E86K)
Ref Sequence ENSEMBL: ENSMUSP00000104543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103065] [ENSMUST00000103066] [ENSMUST00000108915] [ENSMUST00000108916] [ENSMUST00000108917]
AlphaFold Q8BYK5
Predicted Effect probably damaging
Transcript: ENSMUST00000103065
AA Change: E45K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099354
Gene: ENSMUSG00000027525
AA Change: E45K

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
RPEL 52 77 2.08e0 SMART
low complexity region 187 206 N/A INTRINSIC
RPEL 360 385 5.1e-4 SMART
low complexity region 387 397 N/A INTRINSIC
RPEL 398 423 3.24e-6 SMART
RPEL 436 461 9.82e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103066
AA Change: E85K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099355
Gene: ENSMUSG00000027525
AA Change: E85K

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
RPEL 92 117 2.08e0 SMART
low complexity region 227 246 N/A INTRINSIC
RPEL 400 425 5.1e-4 SMART
low complexity region 427 437 N/A INTRINSIC
RPEL 438 463 3.24e-6 SMART
RPEL 476 501 9.82e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108915
AA Change: E86K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104543
Gene: ENSMUSG00000027525
AA Change: E86K

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
RPEL 93 118 2.08e0 SMART
low complexity region 228 247 N/A INTRINSIC
RPEL 401 426 5.1e-4 SMART
low complexity region 428 438 N/A INTRINSIC
RPEL 439 464 3.24e-6 SMART
RPEL 477 502 9.82e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108916
AA Change: E81K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104544
Gene: ENSMUSG00000027525
AA Change: E81K

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
RPEL 88 113 2.08e0 SMART
low complexity region 223 242 N/A INTRINSIC
RPEL 396 421 5.1e-4 SMART
low complexity region 423 433 N/A INTRINSIC
RPEL 434 459 3.24e-6 SMART
RPEL 472 497 9.82e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108917
AA Change: E81K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104545
Gene: ENSMUSG00000027525
AA Change: E81K

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
RPEL 88 113 2.08e0 SMART
low complexity region 223 242 N/A INTRINSIC
RPEL 396 421 5.1e-4 SMART
low complexity region 423 433 N/A INTRINSIC
RPEL 436 458 2.74e-4 SMART
RPEL 471 496 9.82e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatase and actin regulator protein family. The encoded protein is associated with the nuclear scaffold in proliferating cells, and binds to actin and the catalytic subunit of protein phosphatase-1, suggesting that it functions as a regulatory subunit of protein phosphatase-1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,212,932 (GRCm39) Y120N probably benign Het
AAdacl4fm3 A T 4: 144,429,942 (GRCm39) V349D possibly damaging Het
Alox8 T A 11: 69,087,911 (GRCm39) H131L probably benign Het
Atp13a1 A G 8: 70,252,087 (GRCm39) E588G probably damaging Het
AU040320 G A 4: 126,733,441 (GRCm39) V654M probably damaging Het
Bicra A G 7: 15,713,101 (GRCm39) L982P probably damaging Het
Cdh11 A T 8: 103,406,257 (GRCm39) V72E probably damaging Het
Cfap65 T C 1: 74,958,501 (GRCm39) T869A probably benign Het
Cplane1 A G 15: 8,254,893 (GRCm39) T27A unknown Het
Ddx19a A G 8: 111,705,107 (GRCm39) F338S probably damaging Het
Dhrs7c T A 11: 67,705,904 (GRCm39) V219E probably damaging Het
Dhx33 A G 11: 70,892,424 (GRCm39) V115A probably damaging Het
Dst A G 1: 34,231,866 (GRCm39) D3153G probably benign Het
Ecpas A T 4: 58,850,938 (GRCm39) S412T probably benign Het
Eif5b T C 1: 38,076,740 (GRCm39) probably null Het
Ep300 A G 15: 81,492,516 (GRCm39) N284S unknown Het
Fam83a A G 15: 57,849,513 (GRCm39) N19S probably benign Het
Fgd5 A T 6: 91,965,278 (GRCm39) T504S probably benign Het
Flt4 G A 11: 49,535,260 (GRCm39) probably null Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Gls A G 1: 52,251,427 (GRCm39) V310A probably damaging Het
Gm5414 A T 15: 101,536,582 (GRCm39) C14* probably null Het
Gm9887 C G 12: 69,418,629 (GRCm39) A202P unknown Het
Ifi214 T C 1: 173,355,479 (GRCm39) T110A possibly damaging Het
Il4i1 A G 7: 44,489,113 (GRCm39) R293G probably benign Het
Itpr1 A T 6: 108,383,063 (GRCm39) T1464S probably damaging Het
Kif18a T C 2: 109,123,400 (GRCm39) S225P probably damaging Het
Kif21a A T 15: 90,855,330 (GRCm39) I678N probably damaging Het
Klf11 T A 12: 24,710,240 (GRCm39) D429E probably damaging Het
Kntc1 A G 5: 123,939,948 (GRCm39) T1581A probably benign Het
Lama2 T C 10: 27,343,338 (GRCm39) N45D possibly damaging Het
Lrrk1 T C 7: 65,924,623 (GRCm39) I1319V probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Malrd1 C T 2: 15,701,638 (GRCm39) T751I unknown Het
Matcap1 A T 8: 106,009,820 (GRCm39) D376E probably benign Het
Mgat5b T C 11: 116,857,595 (GRCm39) L363P probably damaging Het
Mphosph9 A T 5: 124,436,738 (GRCm39) S535R possibly damaging Het
Nckap5 C T 1: 125,955,017 (GRCm39) D512N probably damaging Het
Ngef T A 1: 87,406,857 (GRCm39) D637V probably damaging Het
Nup93 T C 8: 95,030,313 (GRCm39) Y391H probably damaging Het
Or10j7 C A 1: 173,011,915 (GRCm39) V29F probably benign Het
Or4c110 T C 2: 88,832,060 (GRCm39) T191A Het
Or5b3 A T 19: 13,388,334 (GRCm39) T134S probably benign Het
Pcdhb4 C A 18: 37,442,905 (GRCm39) D738E possibly damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Psd C T 19: 46,311,628 (GRCm39) D351N probably benign Het
Pzp A G 6: 128,472,154 (GRCm39) probably null Het
Rerg T A 6: 137,033,415 (GRCm39) K106* probably null Het
Samd9l T C 6: 3,375,854 (GRCm39) E469G possibly damaging Het
Smok2b C A 17: 13,453,865 (GRCm39) Y8* probably null Het
Spata31e3 T C 13: 50,400,688 (GRCm39) Y546C possibly damaging Het
Spn A G 7: 126,735,437 (GRCm39) S357P probably benign Het
Tek T G 4: 94,692,539 (GRCm39) W216G possibly damaging Het
Trpm3 A T 19: 22,866,762 (GRCm39) H531L probably benign Het
Trpm6 A G 19: 18,807,336 (GRCm39) M1027V probably benign Het
Tsc2 G A 17: 24,818,616 (GRCm39) R1408* probably null Het
Tut4 T A 4: 108,412,778 (GRCm39) M1493K probably benign Het
Unc13b A G 4: 43,101,869 (GRCm39) N155D probably benign Het
Vmn1r52 G A 6: 90,156,008 (GRCm39) C104Y probably damaging Het
Xylt1 A T 7: 117,148,255 (GRCm39) E273V probably damaging Het
Zc3h4 C A 7: 16,168,770 (GRCm39) Q1035K unknown Het
Zfp14 A T 7: 29,738,609 (GRCm39) S125R probably benign Het
Other mutations in Phactr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Phactr3 APN 2 177,920,855 (GRCm39) missense probably benign 0.00
IGL01432:Phactr3 APN 2 177,924,893 (GRCm39) missense probably benign 0.05
IGL01580:Phactr3 APN 2 177,911,297 (GRCm39) splice site probably benign
IGL02688:Phactr3 APN 2 177,920,792 (GRCm39) missense probably damaging 0.96
IGL02985:Phactr3 APN 2 177,817,250 (GRCm39) missense probably benign
PIT4151001:Phactr3 UTSW 2 177,975,861 (GRCm39) missense probably damaging 1.00
R1854:Phactr3 UTSW 2 177,924,940 (GRCm39) missense probably damaging 1.00
R2132:Phactr3 UTSW 2 177,925,759 (GRCm39) missense probably benign 0.14
R3110:Phactr3 UTSW 2 177,920,810 (GRCm39) missense possibly damaging 0.85
R3112:Phactr3 UTSW 2 177,920,810 (GRCm39) missense possibly damaging 0.85
R3122:Phactr3 UTSW 2 177,973,411 (GRCm39) missense probably damaging 1.00
R4193:Phactr3 UTSW 2 177,924,945 (GRCm39) missense probably damaging 0.98
R4194:Phactr3 UTSW 2 177,924,902 (GRCm39) missense possibly damaging 0.80
R4243:Phactr3 UTSW 2 177,924,982 (GRCm39) splice site probably null
R4245:Phactr3 UTSW 2 177,924,982 (GRCm39) splice site probably null
R4397:Phactr3 UTSW 2 177,817,199 (GRCm39) intron probably benign
R4433:Phactr3 UTSW 2 177,924,925 (GRCm39) missense probably damaging 1.00
R4581:Phactr3 UTSW 2 177,924,965 (GRCm39) missense probably damaging 1.00
R4772:Phactr3 UTSW 2 177,925,729 (GRCm39) missense probably damaging 1.00
R4830:Phactr3 UTSW 2 177,925,811 (GRCm39) missense probably damaging 0.98
R5045:Phactr3 UTSW 2 177,973,412 (GRCm39) missense probably damaging 1.00
R5442:Phactr3 UTSW 2 177,784,254 (GRCm39) missense probably benign 0.38
R5461:Phactr3 UTSW 2 177,920,694 (GRCm39) missense probably benign
R5816:Phactr3 UTSW 2 177,944,586 (GRCm39) missense probably damaging 1.00
R6276:Phactr3 UTSW 2 177,920,812 (GRCm39) missense probably damaging 0.99
R6668:Phactr3 UTSW 2 177,974,657 (GRCm39) missense probably damaging 1.00
R7144:Phactr3 UTSW 2 177,944,529 (GRCm39) missense probably damaging 1.00
R7340:Phactr3 UTSW 2 177,975,854 (GRCm39) missense probably damaging 1.00
R7798:Phactr3 UTSW 2 177,925,703 (GRCm39) missense probably benign 0.19
R8009:Phactr3 UTSW 2 177,974,737 (GRCm39) missense probably damaging 1.00
R8074:Phactr3 UTSW 2 177,944,589 (GRCm39) missense probably damaging 1.00
R8348:Phactr3 UTSW 2 177,897,935 (GRCm39) missense probably benign 0.03
R8530:Phactr3 UTSW 2 177,925,819 (GRCm39) missense probably damaging 1.00
R9077:Phactr3 UTSW 2 177,974,758 (GRCm39) splice site probably benign
R9153:Phactr3 UTSW 2 177,925,739 (GRCm39) missense possibly damaging 0.79
R9406:Phactr3 UTSW 2 177,925,856 (GRCm39) missense probably damaging 0.99
R9676:Phactr3 UTSW 2 177,925,837 (GRCm39) nonsense probably null
R9722:Phactr3 UTSW 2 177,898,043 (GRCm39) missense probably damaging 1.00
R9776:Phactr3 UTSW 2 177,975,896 (GRCm39) missense probably damaging 1.00
R9778:Phactr3 UTSW 2 177,924,805 (GRCm39) missense possibly damaging 0.73
Z1176:Phactr3 UTSW 2 177,911,167 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAAATCATCCCTTGAGACCCTTC -3'
(R):5'- TCTGTGAGCAGGGATAGCAG -3'

Sequencing Primer
(F):5'- TCCCTGTTCTTACTTTACAGATGAG -3'
(R):5'- AAGAGCACTGCTGTTCTTCCAGAG -3'
Posted On 2022-10-06