Incidental Mutation 'R9721:Unc13b'
ID 730774
Institutional Source Beutler Lab
Gene Symbol Unc13b
Ensembl Gene ENSMUSG00000028456
Gene Name unc-13 homolog B
Synonyms Munc13-2, Unc13h2
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 43058953-43264871 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43101869 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 155 (N155D)
Ref Sequence ENSEMBL: ENSMUSP00000103586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569]
AlphaFold Q9Z1N9
Predicted Effect probably benign
Transcript: ENSMUST00000079978
AA Change: N155D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456
AA Change: N155D

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1262 1404 4.8e-60 PFAM
C2 1438 1544 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107952
AA Change: N155D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456
AA Change: N155D

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1033 2.02e-53 SMART
Pfam:Membr_traf_MHD 1274 1416 4.8e-60 PFAM
C2 1450 1556 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107953
AA Change: N155D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456
AA Change: N155D

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1263 1403 2.3e-56 PFAM
C2 1457 1563 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163653
AA Change: N155D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456
AA Change: N155D

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1032 4.64e-53 SMART
Pfam:Membr_traf_MHD 1273 1415 4.8e-60 PFAM
C2 1449 1555 7.56e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000207569
AA Change: N155D
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,212,932 (GRCm39) Y120N probably benign Het
AAdacl4fm3 A T 4: 144,429,942 (GRCm39) V349D possibly damaging Het
Alox8 T A 11: 69,087,911 (GRCm39) H131L probably benign Het
Atp13a1 A G 8: 70,252,087 (GRCm39) E588G probably damaging Het
AU040320 G A 4: 126,733,441 (GRCm39) V654M probably damaging Het
Bicra A G 7: 15,713,101 (GRCm39) L982P probably damaging Het
Cdh11 A T 8: 103,406,257 (GRCm39) V72E probably damaging Het
Cfap65 T C 1: 74,958,501 (GRCm39) T869A probably benign Het
Cplane1 A G 15: 8,254,893 (GRCm39) T27A unknown Het
Ddx19a A G 8: 111,705,107 (GRCm39) F338S probably damaging Het
Dhrs7c T A 11: 67,705,904 (GRCm39) V219E probably damaging Het
Dhx33 A G 11: 70,892,424 (GRCm39) V115A probably damaging Het
Dst A G 1: 34,231,866 (GRCm39) D3153G probably benign Het
Ecpas A T 4: 58,850,938 (GRCm39) S412T probably benign Het
Eif5b T C 1: 38,076,740 (GRCm39) probably null Het
Ep300 A G 15: 81,492,516 (GRCm39) N284S unknown Het
Fam83a A G 15: 57,849,513 (GRCm39) N19S probably benign Het
Fgd5 A T 6: 91,965,278 (GRCm39) T504S probably benign Het
Flt4 G A 11: 49,535,260 (GRCm39) probably null Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Gls A G 1: 52,251,427 (GRCm39) V310A probably damaging Het
Gm5414 A T 15: 101,536,582 (GRCm39) C14* probably null Het
Gm9887 C G 12: 69,418,629 (GRCm39) A202P unknown Het
Ifi214 T C 1: 173,355,479 (GRCm39) T110A possibly damaging Het
Il4i1 A G 7: 44,489,113 (GRCm39) R293G probably benign Het
Itpr1 A T 6: 108,383,063 (GRCm39) T1464S probably damaging Het
Kif18a T C 2: 109,123,400 (GRCm39) S225P probably damaging Het
Kif21a A T 15: 90,855,330 (GRCm39) I678N probably damaging Het
Klf11 T A 12: 24,710,240 (GRCm39) D429E probably damaging Het
Kntc1 A G 5: 123,939,948 (GRCm39) T1581A probably benign Het
Lama2 T C 10: 27,343,338 (GRCm39) N45D possibly damaging Het
Lrrk1 T C 7: 65,924,623 (GRCm39) I1319V probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Malrd1 C T 2: 15,701,638 (GRCm39) T751I unknown Het
Matcap1 A T 8: 106,009,820 (GRCm39) D376E probably benign Het
Mgat5b T C 11: 116,857,595 (GRCm39) L363P probably damaging Het
Mphosph9 A T 5: 124,436,738 (GRCm39) S535R possibly damaging Het
Nckap5 C T 1: 125,955,017 (GRCm39) D512N probably damaging Het
Ngef T A 1: 87,406,857 (GRCm39) D637V probably damaging Het
Nup93 T C 8: 95,030,313 (GRCm39) Y391H probably damaging Het
Or10j7 C A 1: 173,011,915 (GRCm39) V29F probably benign Het
Or4c110 T C 2: 88,832,060 (GRCm39) T191A Het
Or5b3 A T 19: 13,388,334 (GRCm39) T134S probably benign Het
Pcdhb4 C A 18: 37,442,905 (GRCm39) D738E possibly damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Phactr3 G A 2: 177,898,043 (GRCm39) E86K probably damaging Het
Psd C T 19: 46,311,628 (GRCm39) D351N probably benign Het
Pzp A G 6: 128,472,154 (GRCm39) probably null Het
Rerg T A 6: 137,033,415 (GRCm39) K106* probably null Het
Samd9l T C 6: 3,375,854 (GRCm39) E469G possibly damaging Het
Smok2b C A 17: 13,453,865 (GRCm39) Y8* probably null Het
Spata31e3 T C 13: 50,400,688 (GRCm39) Y546C possibly damaging Het
Spn A G 7: 126,735,437 (GRCm39) S357P probably benign Het
Tek T G 4: 94,692,539 (GRCm39) W216G possibly damaging Het
Trpm3 A T 19: 22,866,762 (GRCm39) H531L probably benign Het
Trpm6 A G 19: 18,807,336 (GRCm39) M1027V probably benign Het
Tsc2 G A 17: 24,818,616 (GRCm39) R1408* probably null Het
Tut4 T A 4: 108,412,778 (GRCm39) M1493K probably benign Het
Vmn1r52 G A 6: 90,156,008 (GRCm39) C104Y probably damaging Het
Xylt1 A T 7: 117,148,255 (GRCm39) E273V probably damaging Het
Zc3h4 C A 7: 16,168,770 (GRCm39) Q1035K unknown Het
Zfp14 A T 7: 29,738,609 (GRCm39) S125R probably benign Het
Other mutations in Unc13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Unc13b APN 4 43,240,285 (GRCm39) missense probably damaging 1.00
IGL00832:Unc13b APN 4 43,258,921 (GRCm39) missense probably damaging 1.00
IGL01111:Unc13b APN 4 43,096,927 (GRCm39) missense possibly damaging 0.76
IGL01115:Unc13b APN 4 43,258,492 (GRCm39) missense probably damaging 1.00
IGL01137:Unc13b APN 4 43,091,291 (GRCm39) missense probably damaging 1.00
IGL01637:Unc13b APN 4 43,241,066 (GRCm39) missense probably damaging 1.00
IGL01789:Unc13b APN 4 43,239,462 (GRCm39) missense probably damaging 1.00
IGL01792:Unc13b APN 4 43,250,218 (GRCm39) missense probably damaging 0.99
IGL01877:Unc13b APN 4 43,249,583 (GRCm39) critical splice donor site probably null
IGL01924:Unc13b APN 4 43,239,385 (GRCm39) nonsense probably null
IGL02087:Unc13b APN 4 43,091,270 (GRCm39) missense probably null 1.00
IGL02197:Unc13b APN 4 43,165,828 (GRCm39) missense probably damaging 0.99
IGL02504:Unc13b APN 4 43,263,031 (GRCm39) missense probably damaging 1.00
IGL02659:Unc13b APN 4 43,235,332 (GRCm39) missense probably damaging 1.00
IGL03031:Unc13b APN 4 43,235,368 (GRCm39) missense probably damaging 1.00
IGL03036:Unc13b APN 4 43,235,249 (GRCm39) missense probably damaging 1.00
IGL03209:Unc13b APN 4 43,239,351 (GRCm39) missense probably damaging 0.99
IGL03352:Unc13b APN 4 43,237,110 (GRCm39) missense possibly damaging 0.90
BB006:Unc13b UTSW 4 43,174,399 (GRCm39) missense unknown
BB016:Unc13b UTSW 4 43,174,399 (GRCm39) missense unknown
G1Funyon:Unc13b UTSW 4 43,263,568 (GRCm39) missense probably benign
P0028:Unc13b UTSW 4 43,256,225 (GRCm39) missense probably damaging 1.00
PIT4585001:Unc13b UTSW 4 43,091,298 (GRCm39) missense probably benign 0.03
R0019:Unc13b UTSW 4 43,096,990 (GRCm39) missense possibly damaging 0.58
R0019:Unc13b UTSW 4 43,096,990 (GRCm39) missense possibly damaging 0.58
R0335:Unc13b UTSW 4 43,236,983 (GRCm39) missense possibly damaging 0.95
R0504:Unc13b UTSW 4 43,263,559 (GRCm39) missense probably damaging 0.99
R0631:Unc13b UTSW 4 43,182,849 (GRCm39) missense possibly damaging 0.47
R0748:Unc13b UTSW 4 43,241,164 (GRCm39) splice site probably benign
R1275:Unc13b UTSW 4 43,235,366 (GRCm39) missense probably damaging 1.00
R1293:Unc13b UTSW 4 43,235,190 (GRCm39) missense probably damaging 1.00
R1434:Unc13b UTSW 4 43,239,385 (GRCm39) nonsense probably null
R1552:Unc13b UTSW 4 43,237,144 (GRCm39) missense probably damaging 0.99
R1591:Unc13b UTSW 4 43,244,747 (GRCm39) missense probably damaging 1.00
R1628:Unc13b UTSW 4 43,263,371 (GRCm39) missense probably damaging 1.00
R1740:Unc13b UTSW 4 43,240,285 (GRCm39) missense probably damaging 1.00
R1839:Unc13b UTSW 4 43,258,308 (GRCm39) splice site probably benign
R2045:Unc13b UTSW 4 43,091,266 (GRCm39) missense probably damaging 1.00
R2191:Unc13b UTSW 4 43,245,566 (GRCm39) nonsense probably null
R2259:Unc13b UTSW 4 43,182,780 (GRCm39) missense possibly damaging 0.87
R2307:Unc13b UTSW 4 43,239,854 (GRCm39) missense probably damaging 0.98
R2317:Unc13b UTSW 4 43,245,514 (GRCm39) missense probably damaging 1.00
R2402:Unc13b UTSW 4 43,095,843 (GRCm39) missense probably benign
R2847:Unc13b UTSW 4 43,180,404 (GRCm39) missense probably benign 0.04
R3414:Unc13b UTSW 4 43,234,658 (GRCm39) splice site probably benign
R3436:Unc13b UTSW 4 43,097,028 (GRCm39) splice site probably benign
R3955:Unc13b UTSW 4 43,256,834 (GRCm39) missense probably damaging 1.00
R3957:Unc13b UTSW 4 43,256,834 (GRCm39) missense probably damaging 1.00
R4015:Unc13b UTSW 4 43,237,801 (GRCm39) missense probably damaging 1.00
R4650:Unc13b UTSW 4 43,261,035 (GRCm39) missense probably damaging 0.97
R4836:Unc13b UTSW 4 43,237,137 (GRCm39) missense probably damaging 1.00
R5041:Unc13b UTSW 4 43,237,836 (GRCm39) missense probably benign 0.41
R5413:Unc13b UTSW 4 43,257,936 (GRCm39) critical splice donor site probably null
R5994:Unc13b UTSW 4 43,172,596 (GRCm39) intron probably benign
R6015:Unc13b UTSW 4 43,177,995 (GRCm39) nonsense probably null
R6090:Unc13b UTSW 4 43,239,306 (GRCm39) missense probably damaging 1.00
R6242:Unc13b UTSW 4 43,165,800 (GRCm39) missense possibly damaging 0.92
R6246:Unc13b UTSW 4 43,216,246 (GRCm39) missense probably benign 0.18
R6427:Unc13b UTSW 4 43,176,966 (GRCm39) unclassified probably benign
R6660:Unc13b UTSW 4 43,177,412 (GRCm39) unclassified probably benign
R6670:Unc13b UTSW 4 43,255,562 (GRCm39) missense probably damaging 0.99
R6753:Unc13b UTSW 4 43,239,331 (GRCm39) missense probably damaging 1.00
R6858:Unc13b UTSW 4 43,165,828 (GRCm39) missense possibly damaging 0.85
R6886:Unc13b UTSW 4 43,170,156 (GRCm39) intron probably benign
R6969:Unc13b UTSW 4 43,263,538 (GRCm39) missense possibly damaging 0.94
R6994:Unc13b UTSW 4 43,173,203 (GRCm39) intron probably benign
R6994:Unc13b UTSW 4 43,171,403 (GRCm39) intron probably benign
R7080:Unc13b UTSW 4 43,171,926 (GRCm39) missense unknown
R7117:Unc13b UTSW 4 43,216,544 (GRCm39) missense probably benign 0.33
R7132:Unc13b UTSW 4 43,215,757 (GRCm39) missense probably benign 0.17
R7181:Unc13b UTSW 4 43,258,893 (GRCm39) missense probably damaging 0.99
R7192:Unc13b UTSW 4 43,258,519 (GRCm39) missense probably damaging 1.00
R7246:Unc13b UTSW 4 43,172,910 (GRCm39) missense unknown
R7342:Unc13b UTSW 4 43,258,703 (GRCm39) missense probably damaging 0.99
R7345:Unc13b UTSW 4 43,173,966 (GRCm39) missense unknown
R7355:Unc13b UTSW 4 43,237,754 (GRCm39) missense probably damaging 1.00
R7391:Unc13b UTSW 4 43,216,459 (GRCm39) missense probably benign 0.03
R7419:Unc13b UTSW 4 43,174,023 (GRCm39) missense unknown
R7424:Unc13b UTSW 4 43,172,235 (GRCm39) missense unknown
R7517:Unc13b UTSW 4 43,215,765 (GRCm39) missense probably benign
R7532:Unc13b UTSW 4 43,249,565 (GRCm39) missense probably benign 0.44
R7564:Unc13b UTSW 4 43,091,258 (GRCm39) missense probably damaging 1.00
R7598:Unc13b UTSW 4 43,263,569 (GRCm39) missense probably benign 0.20
R7604:Unc13b UTSW 4 43,256,776 (GRCm39) missense possibly damaging 0.95
R7604:Unc13b UTSW 4 43,170,102 (GRCm39) missense unknown
R7643:Unc13b UTSW 4 43,216,333 (GRCm39) missense probably benign
R7718:Unc13b UTSW 4 43,173,854 (GRCm39) missense unknown
R7735:Unc13b UTSW 4 43,165,791 (GRCm39) missense probably damaging 1.00
R7756:Unc13b UTSW 4 43,177,312 (GRCm39) small deletion probably benign
R7757:Unc13b UTSW 4 43,177,341 (GRCm39) small insertion probably benign
R7757:Unc13b UTSW 4 43,177,330 (GRCm39) small insertion probably benign
R7757:Unc13b UTSW 4 43,177,312 (GRCm39) small deletion probably benign
R7758:Unc13b UTSW 4 43,177,344 (GRCm39) small insertion probably benign
R7758:Unc13b UTSW 4 43,177,312 (GRCm39) small insertion probably benign
R7781:Unc13b UTSW 4 43,259,546 (GRCm39) missense possibly damaging 0.87
R7793:Unc13b UTSW 4 43,172,737 (GRCm39) missense unknown
R7858:Unc13b UTSW 4 43,176,285 (GRCm39) missense unknown
R7867:Unc13b UTSW 4 43,232,573 (GRCm39) nonsense probably null
R7897:Unc13b UTSW 4 43,171,860 (GRCm39) missense unknown
R7904:Unc13b UTSW 4 43,217,075 (GRCm39) missense probably benign
R7929:Unc13b UTSW 4 43,174,399 (GRCm39) missense unknown
R7984:Unc13b UTSW 4 43,173,973 (GRCm39) missense unknown
R8069:Unc13b UTSW 4 43,177,597 (GRCm39) missense unknown
R8101:Unc13b UTSW 4 43,239,918 (GRCm39) missense probably benign 0.08
R8246:Unc13b UTSW 4 43,175,954 (GRCm39) missense unknown
R8289:Unc13b UTSW 4 43,172,524 (GRCm39) nonsense probably null
R8301:Unc13b UTSW 4 43,263,568 (GRCm39) missense probably benign
R8397:Unc13b UTSW 4 43,217,290 (GRCm39) missense probably benign 0.12
R8421:Unc13b UTSW 4 43,178,304 (GRCm39) missense unknown
R8738:Unc13b UTSW 4 43,177,564 (GRCm39) missense unknown
R8746:Unc13b UTSW 4 43,176,120 (GRCm39) missense unknown
R8766:Unc13b UTSW 4 43,174,722 (GRCm39) missense unknown
R8825:Unc13b UTSW 4 43,237,683 (GRCm39) splice site probably benign
R8834:Unc13b UTSW 4 43,175,954 (GRCm39) missense unknown
R8862:Unc13b UTSW 4 43,235,207 (GRCm39) missense probably damaging 1.00
R8864:Unc13b UTSW 4 43,174,724 (GRCm39) missense unknown
R8889:Unc13b UTSW 4 43,176,484 (GRCm39) missense unknown
R8892:Unc13b UTSW 4 43,176,484 (GRCm39) missense unknown
R8904:Unc13b UTSW 4 43,178,531 (GRCm39) intron probably benign
R9089:Unc13b UTSW 4 43,095,847 (GRCm39) missense probably damaging 1.00
R9144:Unc13b UTSW 4 43,173,649 (GRCm39) missense unknown
R9149:Unc13b UTSW 4 43,176,186 (GRCm39) missense unknown
R9173:Unc13b UTSW 4 43,177,421 (GRCm39) missense unknown
R9200:Unc13b UTSW 4 43,257,352 (GRCm39) missense possibly damaging 0.50
R9232:Unc13b UTSW 4 43,240,321 (GRCm39) missense probably benign 0.03
R9269:Unc13b UTSW 4 43,171,955 (GRCm39) missense unknown
R9320:Unc13b UTSW 4 43,171,044 (GRCm39) missense unknown
R9335:Unc13b UTSW 4 43,255,551 (GRCm39) missense probably damaging 0.99
R9335:Unc13b UTSW 4 43,216,123 (GRCm39) missense possibly damaging 0.86
R9352:Unc13b UTSW 4 43,177,313 (GRCm39) nonsense probably null
R9352:Unc13b UTSW 4 43,177,312 (GRCm39) small insertion probably benign
R9378:Unc13b UTSW 4 43,173,282 (GRCm39) missense unknown
R9382:Unc13b UTSW 4 43,172,512 (GRCm39) missense unknown
R9569:Unc13b UTSW 4 43,177,312 (GRCm39) small deletion probably benign
R9622:Unc13b UTSW 4 43,172,513 (GRCm39) missense
R9687:Unc13b UTSW 4 43,174,920 (GRCm39) missense unknown
R9704:Unc13b UTSW 4 43,237,102 (GRCm39) missense probably benign 0.31
R9753:Unc13b UTSW 4 43,182,842 (GRCm39) nonsense probably null
RF016:Unc13b UTSW 4 43,177,350 (GRCm39) small insertion probably benign
RF016:Unc13b UTSW 4 43,177,347 (GRCm39) small insertion probably benign
RF041:Unc13b UTSW 4 43,177,338 (GRCm39) small insertion probably benign
RF056:Unc13b UTSW 4 43,177,359 (GRCm39) small insertion probably benign
Z1176:Unc13b UTSW 4 43,177,764 (GRCm39) missense unknown
Z1176:Unc13b UTSW 4 43,177,191 (GRCm39) missense unknown
Z1176:Unc13b UTSW 4 43,171,419 (GRCm39) missense unknown
Z1176:Unc13b UTSW 4 43,261,043 (GRCm39) missense probably benign 0.11
Z1177:Unc13b UTSW 4 43,173,669 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGTCAGTGATGTTCATGTCAACAG -3'
(R):5'- GTGTCTCATTGGTAAAGCACGGG -3'

Sequencing Primer
(F):5'- AGTCACAGTGAGCATTCGTC -3'
(R):5'- CTCATTGGTAAAGCACGGGTTTAG -3'
Posted On 2022-10-06