Incidental Mutation 'R9721:AU040320'
ID 730778
Institutional Source Beutler Lab
Gene Symbol AU040320
Ensembl Gene ENSMUSG00000028830
Gene Name expressed sequence AU040320
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 126647331-126763487 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 126733441 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 654 (V654M)
Ref Sequence ENSEMBL: ENSMUSP00000099667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047431] [ENSMUST00000102607] [ENSMUST00000102608]
AlphaFold Q8K135
Predicted Effect probably damaging
Transcript: ENSMUST00000047431
AA Change: V654M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037802
Gene: ENSMUSG00000028830
AA Change: V654M

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102607
AA Change: V654M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099667
Gene: ENSMUSG00000028830
AA Change: V654M

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102608
AA Change: V654M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099668
Gene: ENSMUSG00000028830
AA Change: V654M

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate gene for dyslexia susceptibility.[provided by RefSeq, Apr 2009]
PHENOTYPE: Null mice display decreased susceptibility to adenoviral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,212,932 (GRCm39) Y120N probably benign Het
AAdacl4fm3 A T 4: 144,429,942 (GRCm39) V349D possibly damaging Het
Alox8 T A 11: 69,087,911 (GRCm39) H131L probably benign Het
Atp13a1 A G 8: 70,252,087 (GRCm39) E588G probably damaging Het
Bicra A G 7: 15,713,101 (GRCm39) L982P probably damaging Het
Cdh11 A T 8: 103,406,257 (GRCm39) V72E probably damaging Het
Cfap65 T C 1: 74,958,501 (GRCm39) T869A probably benign Het
Cplane1 A G 15: 8,254,893 (GRCm39) T27A unknown Het
Ddx19a A G 8: 111,705,107 (GRCm39) F338S probably damaging Het
Dhrs7c T A 11: 67,705,904 (GRCm39) V219E probably damaging Het
Dhx33 A G 11: 70,892,424 (GRCm39) V115A probably damaging Het
Dst A G 1: 34,231,866 (GRCm39) D3153G probably benign Het
Ecpas A T 4: 58,850,938 (GRCm39) S412T probably benign Het
Eif5b T C 1: 38,076,740 (GRCm39) probably null Het
Ep300 A G 15: 81,492,516 (GRCm39) N284S unknown Het
Fam83a A G 15: 57,849,513 (GRCm39) N19S probably benign Het
Fgd5 A T 6: 91,965,278 (GRCm39) T504S probably benign Het
Flt4 G A 11: 49,535,260 (GRCm39) probably null Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Gls A G 1: 52,251,427 (GRCm39) V310A probably damaging Het
Gm5414 A T 15: 101,536,582 (GRCm39) C14* probably null Het
Gm9887 C G 12: 69,418,629 (GRCm39) A202P unknown Het
Ifi214 T C 1: 173,355,479 (GRCm39) T110A possibly damaging Het
Il4i1 A G 7: 44,489,113 (GRCm39) R293G probably benign Het
Itpr1 A T 6: 108,383,063 (GRCm39) T1464S probably damaging Het
Kif18a T C 2: 109,123,400 (GRCm39) S225P probably damaging Het
Kif21a A T 15: 90,855,330 (GRCm39) I678N probably damaging Het
Klf11 T A 12: 24,710,240 (GRCm39) D429E probably damaging Het
Kntc1 A G 5: 123,939,948 (GRCm39) T1581A probably benign Het
Lama2 T C 10: 27,343,338 (GRCm39) N45D possibly damaging Het
Lrrk1 T C 7: 65,924,623 (GRCm39) I1319V probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Malrd1 C T 2: 15,701,638 (GRCm39) T751I unknown Het
Matcap1 A T 8: 106,009,820 (GRCm39) D376E probably benign Het
Mgat5b T C 11: 116,857,595 (GRCm39) L363P probably damaging Het
Mphosph9 A T 5: 124,436,738 (GRCm39) S535R possibly damaging Het
Nckap5 C T 1: 125,955,017 (GRCm39) D512N probably damaging Het
Ngef T A 1: 87,406,857 (GRCm39) D637V probably damaging Het
Nup93 T C 8: 95,030,313 (GRCm39) Y391H probably damaging Het
Or10j7 C A 1: 173,011,915 (GRCm39) V29F probably benign Het
Or4c110 T C 2: 88,832,060 (GRCm39) T191A Het
Or5b3 A T 19: 13,388,334 (GRCm39) T134S probably benign Het
Pcdhb4 C A 18: 37,442,905 (GRCm39) D738E possibly damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Phactr3 G A 2: 177,898,043 (GRCm39) E86K probably damaging Het
Psd C T 19: 46,311,628 (GRCm39) D351N probably benign Het
Pzp A G 6: 128,472,154 (GRCm39) probably null Het
Rerg T A 6: 137,033,415 (GRCm39) K106* probably null Het
Samd9l T C 6: 3,375,854 (GRCm39) E469G possibly damaging Het
Smok2b C A 17: 13,453,865 (GRCm39) Y8* probably null Het
Spata31e3 T C 13: 50,400,688 (GRCm39) Y546C possibly damaging Het
Spn A G 7: 126,735,437 (GRCm39) S357P probably benign Het
Tek T G 4: 94,692,539 (GRCm39) W216G possibly damaging Het
Trpm3 A T 19: 22,866,762 (GRCm39) H531L probably benign Het
Trpm6 A G 19: 18,807,336 (GRCm39) M1027V probably benign Het
Tsc2 G A 17: 24,818,616 (GRCm39) R1408* probably null Het
Tut4 T A 4: 108,412,778 (GRCm39) M1493K probably benign Het
Unc13b A G 4: 43,101,869 (GRCm39) N155D probably benign Het
Vmn1r52 G A 6: 90,156,008 (GRCm39) C104Y probably damaging Het
Xylt1 A T 7: 117,148,255 (GRCm39) E273V probably damaging Het
Zc3h4 C A 7: 16,168,770 (GRCm39) Q1035K unknown Het
Zfp14 A T 7: 29,738,609 (GRCm39) S125R probably benign Het
Other mutations in AU040320
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:AU040320 APN 4 126,686,027 (GRCm39) missense probably benign
IGL00835:AU040320 APN 4 126,650,864 (GRCm39) splice site probably null
IGL00964:AU040320 APN 4 126,748,199 (GRCm39) nonsense probably null
IGL00978:AU040320 APN 4 126,722,632 (GRCm39) missense probably benign 0.00
IGL01396:AU040320 APN 4 126,763,171 (GRCm39) intron probably benign
IGL02129:AU040320 APN 4 126,717,485 (GRCm39) missense probably damaging 1.00
IGL02148:AU040320 APN 4 126,733,469 (GRCm39) missense possibly damaging 0.64
IGL02179:AU040320 APN 4 126,729,405 (GRCm39) missense probably benign 0.43
IGL02696:AU040320 APN 4 126,736,380 (GRCm39) missense probably damaging 1.00
PIT4677001:AU040320 UTSW 4 126,686,030 (GRCm39) missense probably benign 0.00
R0063:AU040320 UTSW 4 126,733,465 (GRCm39) missense probably damaging 1.00
R0063:AU040320 UTSW 4 126,733,465 (GRCm39) missense probably damaging 1.00
R0356:AU040320 UTSW 4 126,731,155 (GRCm39) missense probably damaging 1.00
R0865:AU040320 UTSW 4 126,742,677 (GRCm39) missense possibly damaging 0.94
R1165:AU040320 UTSW 4 126,717,433 (GRCm39) splice site probably benign
R1216:AU040320 UTSW 4 126,710,276 (GRCm39) splice site probably benign
R1464:AU040320 UTSW 4 126,685,824 (GRCm39) missense possibly damaging 0.92
R1464:AU040320 UTSW 4 126,685,824 (GRCm39) missense possibly damaging 0.92
R1751:AU040320 UTSW 4 126,734,517 (GRCm39) missense probably damaging 1.00
R1767:AU040320 UTSW 4 126,734,517 (GRCm39) missense probably damaging 1.00
R1900:AU040320 UTSW 4 126,747,073 (GRCm39) splice site probably null
R2173:AU040320 UTSW 4 126,686,069 (GRCm39) missense probably benign 0.02
R2414:AU040320 UTSW 4 126,762,484 (GRCm39) critical splice acceptor site probably null
R4061:AU040320 UTSW 4 126,729,488 (GRCm39) missense probably damaging 1.00
R4354:AU040320 UTSW 4 126,748,192 (GRCm39) unclassified probably benign
R4751:AU040320 UTSW 4 126,748,259 (GRCm39) splice site probably null
R4790:AU040320 UTSW 4 126,741,008 (GRCm39) missense possibly damaging 0.62
R4799:AU040320 UTSW 4 126,733,462 (GRCm39) missense probably benign 0.01
R4825:AU040320 UTSW 4 126,685,586 (GRCm39) missense probably damaging 1.00
R4908:AU040320 UTSW 4 126,747,081 (GRCm39) missense probably damaging 1.00
R4914:AU040320 UTSW 4 126,729,469 (GRCm39) nonsense probably null
R5085:AU040320 UTSW 4 126,722,664 (GRCm39) missense possibly damaging 0.83
R5320:AU040320 UTSW 4 126,717,509 (GRCm39) missense possibly damaging 0.52
R5410:AU040320 UTSW 4 126,717,509 (GRCm39) missense possibly damaging 0.52
R5543:AU040320 UTSW 4 126,735,017 (GRCm39) missense probably damaging 1.00
R5684:AU040320 UTSW 4 126,685,939 (GRCm39) missense probably benign 0.06
R5729:AU040320 UTSW 4 126,724,208 (GRCm39) missense probably damaging 1.00
R5918:AU040320 UTSW 4 126,708,064 (GRCm39) missense probably benign 0.32
R6123:AU040320 UTSW 4 126,763,179 (GRCm39) intron probably benign
R6456:AU040320 UTSW 4 126,736,284 (GRCm39) missense probably benign 0.03
R6523:AU040320 UTSW 4 126,762,553 (GRCm39) critical splice donor site probably null
R6591:AU040320 UTSW 4 126,730,463 (GRCm39) missense possibly damaging 0.81
R6603:AU040320 UTSW 4 126,686,046 (GRCm39) missense probably benign 0.02
R6664:AU040320 UTSW 4 126,729,443 (GRCm39) missense probably damaging 1.00
R6691:AU040320 UTSW 4 126,730,463 (GRCm39) missense possibly damaging 0.81
R6864:AU040320 UTSW 4 126,741,612 (GRCm39) missense probably damaging 0.98
R6891:AU040320 UTSW 4 126,740,231 (GRCm39) missense possibly damaging 0.93
R6895:AU040320 UTSW 4 126,685,723 (GRCm39) missense probably damaging 1.00
R7064:AU040320 UTSW 4 126,685,865 (GRCm39) missense probably benign 0.01
R7351:AU040320 UTSW 4 126,710,237 (GRCm39) missense probably damaging 0.98
R7453:AU040320 UTSW 4 126,729,493 (GRCm39) critical splice donor site probably null
R7467:AU040320 UTSW 4 126,708,103 (GRCm39) missense probably benign 0.06
R7492:AU040320 UTSW 4 126,741,648 (GRCm39) missense possibly damaging 0.56
R7513:AU040320 UTSW 4 126,686,057 (GRCm39) missense probably benign 0.01
R7702:AU040320 UTSW 4 126,708,166 (GRCm39) missense probably benign 0.23
R7733:AU040320 UTSW 4 126,729,322 (GRCm39) missense possibly damaging 0.88
R8079:AU040320 UTSW 4 126,725,953 (GRCm39) missense possibly damaging 0.61
R8430:AU040320 UTSW 4 126,742,693 (GRCm39) missense possibly damaging 0.93
R8984:AU040320 UTSW 4 126,734,936 (GRCm39) missense possibly damaging 0.58
R9328:AU040320 UTSW 4 126,729,332 (GRCm39) missense possibly damaging 0.58
R9501:AU040320 UTSW 4 126,735,032 (GRCm39) missense probably benign 0.11
Z1177:AU040320 UTSW 4 126,736,426 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCTGTGTTTTAGGACCAAGTGATAC -3'
(R):5'- ACATAAGACAGGGCGGACTC -3'

Sequencing Primer
(F):5'- GGACCAAGTGATACTTTCCAAACGG -3'
(R):5'- GCGGACTCCTGGGCTATC -3'
Posted On 2022-10-06