Incidental Mutation 'R9721:Kntc1'
ID 730780
Institutional Source Beutler Lab
Gene Symbol Kntc1
Ensembl Gene ENSMUSG00000029414
Gene Name kinetochore associated 1
Synonyms jgl
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 123887779-123959656 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123939948 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1581 (T1581A)
Ref Sequence ENSEMBL: ENSMUSP00000031366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031366]
AlphaFold Q8C3Y4
Predicted Effect probably benign
Transcript: ENSMUST00000031366
AA Change: T1581A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031366
Gene: ENSMUSG00000029414
AA Change: T1581A

DomainStartEndE-ValueType
low complexity region 345 357 N/A INTRINSIC
low complexity region 747 764 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
Pfam:Rod_C 1579 2128 3.2e-256 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. Experimental evidence indicated that the encoded protein functioned in a similar manner to that of the Drosophila rough deal protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice have a kinked tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,212,932 (GRCm39) Y120N probably benign Het
AAdacl4fm3 A T 4: 144,429,942 (GRCm39) V349D possibly damaging Het
Alox8 T A 11: 69,087,911 (GRCm39) H131L probably benign Het
Atp13a1 A G 8: 70,252,087 (GRCm39) E588G probably damaging Het
AU040320 G A 4: 126,733,441 (GRCm39) V654M probably damaging Het
Bicra A G 7: 15,713,101 (GRCm39) L982P probably damaging Het
Cdh11 A T 8: 103,406,257 (GRCm39) V72E probably damaging Het
Cfap65 T C 1: 74,958,501 (GRCm39) T869A probably benign Het
Cplane1 A G 15: 8,254,893 (GRCm39) T27A unknown Het
Ddx19a A G 8: 111,705,107 (GRCm39) F338S probably damaging Het
Dhrs7c T A 11: 67,705,904 (GRCm39) V219E probably damaging Het
Dhx33 A G 11: 70,892,424 (GRCm39) V115A probably damaging Het
Dst A G 1: 34,231,866 (GRCm39) D3153G probably benign Het
Ecpas A T 4: 58,850,938 (GRCm39) S412T probably benign Het
Eif5b T C 1: 38,076,740 (GRCm39) probably null Het
Ep300 A G 15: 81,492,516 (GRCm39) N284S unknown Het
Fam83a A G 15: 57,849,513 (GRCm39) N19S probably benign Het
Fgd5 A T 6: 91,965,278 (GRCm39) T504S probably benign Het
Flt4 G A 11: 49,535,260 (GRCm39) probably null Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Gls A G 1: 52,251,427 (GRCm39) V310A probably damaging Het
Gm5414 A T 15: 101,536,582 (GRCm39) C14* probably null Het
Gm9887 C G 12: 69,418,629 (GRCm39) A202P unknown Het
Ifi214 T C 1: 173,355,479 (GRCm39) T110A possibly damaging Het
Il4i1 A G 7: 44,489,113 (GRCm39) R293G probably benign Het
Itpr1 A T 6: 108,383,063 (GRCm39) T1464S probably damaging Het
Kif18a T C 2: 109,123,400 (GRCm39) S225P probably damaging Het
Kif21a A T 15: 90,855,330 (GRCm39) I678N probably damaging Het
Klf11 T A 12: 24,710,240 (GRCm39) D429E probably damaging Het
Lama2 T C 10: 27,343,338 (GRCm39) N45D possibly damaging Het
Lrrk1 T C 7: 65,924,623 (GRCm39) I1319V probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Malrd1 C T 2: 15,701,638 (GRCm39) T751I unknown Het
Matcap1 A T 8: 106,009,820 (GRCm39) D376E probably benign Het
Mgat5b T C 11: 116,857,595 (GRCm39) L363P probably damaging Het
Mphosph9 A T 5: 124,436,738 (GRCm39) S535R possibly damaging Het
Nckap5 C T 1: 125,955,017 (GRCm39) D512N probably damaging Het
Ngef T A 1: 87,406,857 (GRCm39) D637V probably damaging Het
Nup93 T C 8: 95,030,313 (GRCm39) Y391H probably damaging Het
Or10j7 C A 1: 173,011,915 (GRCm39) V29F probably benign Het
Or4c110 T C 2: 88,832,060 (GRCm39) T191A Het
Or5b3 A T 19: 13,388,334 (GRCm39) T134S probably benign Het
Pcdhb4 C A 18: 37,442,905 (GRCm39) D738E possibly damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Phactr3 G A 2: 177,898,043 (GRCm39) E86K probably damaging Het
Psd C T 19: 46,311,628 (GRCm39) D351N probably benign Het
Pzp A G 6: 128,472,154 (GRCm39) probably null Het
Rerg T A 6: 137,033,415 (GRCm39) K106* probably null Het
Samd9l T C 6: 3,375,854 (GRCm39) E469G possibly damaging Het
Smok2b C A 17: 13,453,865 (GRCm39) Y8* probably null Het
Spata31e3 T C 13: 50,400,688 (GRCm39) Y546C possibly damaging Het
Spn A G 7: 126,735,437 (GRCm39) S357P probably benign Het
Tek T G 4: 94,692,539 (GRCm39) W216G possibly damaging Het
Trpm3 A T 19: 22,866,762 (GRCm39) H531L probably benign Het
Trpm6 A G 19: 18,807,336 (GRCm39) M1027V probably benign Het
Tsc2 G A 17: 24,818,616 (GRCm39) R1408* probably null Het
Tut4 T A 4: 108,412,778 (GRCm39) M1493K probably benign Het
Unc13b A G 4: 43,101,869 (GRCm39) N155D probably benign Het
Vmn1r52 G A 6: 90,156,008 (GRCm39) C104Y probably damaging Het
Xylt1 A T 7: 117,148,255 (GRCm39) E273V probably damaging Het
Zc3h4 C A 7: 16,168,770 (GRCm39) Q1035K unknown Het
Zfp14 A T 7: 29,738,609 (GRCm39) S125R probably benign Het
Other mutations in Kntc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kntc1 APN 5 123,928,222 (GRCm39) missense probably benign 0.05
IGL00514:Kntc1 APN 5 123,929,590 (GRCm39) missense probably benign 0.00
IGL01103:Kntc1 APN 5 123,902,283 (GRCm39) missense probably damaging 0.96
IGL01106:Kntc1 APN 5 123,900,666 (GRCm39) missense probably benign 0.01
IGL01357:Kntc1 APN 5 123,895,877 (GRCm39) missense probably damaging 1.00
IGL01367:Kntc1 APN 5 123,896,546 (GRCm39) missense probably damaging 1.00
IGL01538:Kntc1 APN 5 123,919,721 (GRCm39) missense probably damaging 1.00
IGL01546:Kntc1 APN 5 123,903,068 (GRCm39) missense probably benign 0.02
IGL01595:Kntc1 APN 5 123,941,758 (GRCm39) missense probably benign 0.30
IGL01725:Kntc1 APN 5 123,902,253 (GRCm39) missense probably benign
IGL01916:Kntc1 APN 5 123,939,976 (GRCm39) missense probably damaging 1.00
IGL01936:Kntc1 APN 5 123,949,439 (GRCm39) missense probably damaging 1.00
IGL01942:Kntc1 APN 5 123,916,330 (GRCm39) missense probably damaging 1.00
IGL01973:Kntc1 APN 5 123,904,021 (GRCm39) missense probably damaging 1.00
IGL01982:Kntc1 APN 5 123,947,159 (GRCm39) missense probably benign 0.12
IGL02145:Kntc1 APN 5 123,900,661 (GRCm39) missense possibly damaging 0.80
IGL02510:Kntc1 APN 5 123,957,125 (GRCm39) missense probably benign 0.03
IGL02611:Kntc1 APN 5 123,950,128 (GRCm39) missense probably damaging 1.00
IGL02669:Kntc1 APN 5 123,893,727 (GRCm39) splice site probably benign
IGL02737:Kntc1 APN 5 123,957,183 (GRCm39) missense probably benign 0.17
IGL02793:Kntc1 APN 5 123,916,340 (GRCm39) splice site probably null
IGL02809:Kntc1 APN 5 123,914,645 (GRCm39) missense probably damaging 1.00
IGL02860:Kntc1 APN 5 123,907,936 (GRCm39) missense possibly damaging 0.49
IGL02875:Kntc1 APN 5 123,916,340 (GRCm39) splice site probably null
IGL02931:Kntc1 APN 5 123,937,874 (GRCm39) missense probably damaging 1.00
IGL03169:Kntc1 APN 5 123,913,884 (GRCm39) missense possibly damaging 0.80
IGL03267:Kntc1 APN 5 123,896,543 (GRCm39) missense probably damaging 1.00
R0006:Kntc1 UTSW 5 123,927,201 (GRCm39) missense probably benign 0.19
R0006:Kntc1 UTSW 5 123,927,201 (GRCm39) missense probably benign 0.19
R0017:Kntc1 UTSW 5 123,919,044 (GRCm39) missense probably damaging 1.00
R0125:Kntc1 UTSW 5 123,903,120 (GRCm39) splice site probably benign
R0324:Kntc1 UTSW 5 123,916,175 (GRCm39) missense probably damaging 1.00
R0580:Kntc1 UTSW 5 123,941,732 (GRCm39) missense probably benign 0.00
R0608:Kntc1 UTSW 5 123,924,137 (GRCm39) missense probably damaging 0.98
R0725:Kntc1 UTSW 5 123,907,767 (GRCm39) missense possibly damaging 0.92
R0733:Kntc1 UTSW 5 123,928,979 (GRCm39) missense probably null
R0781:Kntc1 UTSW 5 123,937,965 (GRCm39) splice site probably benign
R0787:Kntc1 UTSW 5 123,934,167 (GRCm39) missense probably benign
R1250:Kntc1 UTSW 5 123,922,262 (GRCm39) missense possibly damaging 0.71
R1253:Kntc1 UTSW 5 123,948,925 (GRCm39) frame shift probably null
R1467:Kntc1 UTSW 5 123,925,047 (GRCm39) missense probably benign 0.04
R1467:Kntc1 UTSW 5 123,925,047 (GRCm39) missense probably benign 0.04
R1481:Kntc1 UTSW 5 123,916,338 (GRCm39) missense probably benign 0.00
R1572:Kntc1 UTSW 5 123,910,176 (GRCm39) missense probably damaging 0.99
R1624:Kntc1 UTSW 5 123,896,540 (GRCm39) missense possibly damaging 0.48
R1749:Kntc1 UTSW 5 123,927,162 (GRCm39) missense probably benign 0.00
R1993:Kntc1 UTSW 5 123,948,874 (GRCm39) critical splice acceptor site probably null
R1993:Kntc1 UTSW 5 123,897,162 (GRCm39) critical splice donor site probably null
R2071:Kntc1 UTSW 5 123,932,340 (GRCm39) splice site probably null
R2237:Kntc1 UTSW 5 123,941,733 (GRCm39) missense possibly damaging 0.50
R2239:Kntc1 UTSW 5 123,941,733 (GRCm39) missense possibly damaging 0.50
R2366:Kntc1 UTSW 5 123,919,255 (GRCm39) missense probably damaging 1.00
R2367:Kntc1 UTSW 5 123,919,255 (GRCm39) missense probably damaging 1.00
R2382:Kntc1 UTSW 5 123,898,411 (GRCm39) missense probably damaging 0.99
R2389:Kntc1 UTSW 5 123,919,255 (GRCm39) missense probably damaging 1.00
R2413:Kntc1 UTSW 5 123,902,212 (GRCm39) missense probably benign 0.01
R2442:Kntc1 UTSW 5 123,948,922 (GRCm39) missense probably damaging 1.00
R2504:Kntc1 UTSW 5 123,916,410 (GRCm39) nonsense probably null
R2943:Kntc1 UTSW 5 123,935,847 (GRCm39) missense possibly damaging 0.68
R3116:Kntc1 UTSW 5 123,940,121 (GRCm39) missense probably damaging 1.00
R4107:Kntc1 UTSW 5 123,900,661 (GRCm39) missense probably damaging 0.99
R4176:Kntc1 UTSW 5 123,914,680 (GRCm39) missense possibly damaging 0.76
R4275:Kntc1 UTSW 5 123,905,842 (GRCm39) missense probably damaging 1.00
R4440:Kntc1 UTSW 5 123,932,216 (GRCm39) missense probably damaging 1.00
R4575:Kntc1 UTSW 5 123,904,018 (GRCm39) missense probably damaging 1.00
R4576:Kntc1 UTSW 5 123,904,018 (GRCm39) missense probably damaging 1.00
R4578:Kntc1 UTSW 5 123,904,018 (GRCm39) missense probably damaging 1.00
R4612:Kntc1 UTSW 5 123,950,706 (GRCm39) missense probably damaging 1.00
R4704:Kntc1 UTSW 5 123,949,496 (GRCm39) missense probably damaging 0.96
R4720:Kntc1 UTSW 5 123,903,086 (GRCm39) missense possibly damaging 0.65
R4784:Kntc1 UTSW 5 123,954,825 (GRCm39) missense possibly damaging 0.89
R4785:Kntc1 UTSW 5 123,954,825 (GRCm39) missense possibly damaging 0.89
R4824:Kntc1 UTSW 5 123,928,196 (GRCm39) nonsense probably null
R4847:Kntc1 UTSW 5 123,940,337 (GRCm39) missense probably benign 0.18
R4849:Kntc1 UTSW 5 123,897,128 (GRCm39) missense probably benign 0.02
R4904:Kntc1 UTSW 5 123,916,396 (GRCm39) missense possibly damaging 0.47
R4922:Kntc1 UTSW 5 123,940,309 (GRCm39) missense probably damaging 0.99
R5080:Kntc1 UTSW 5 123,900,649 (GRCm39) missense possibly damaging 0.68
R5114:Kntc1 UTSW 5 123,919,118 (GRCm39) critical splice donor site probably null
R5171:Kntc1 UTSW 5 123,937,907 (GRCm39) missense probably benign 0.01
R5220:Kntc1 UTSW 5 123,950,160 (GRCm39) missense probably damaging 1.00
R5226:Kntc1 UTSW 5 123,932,235 (GRCm39) missense probably benign 0.09
R5278:Kntc1 UTSW 5 123,919,077 (GRCm39) missense probably damaging 1.00
R5329:Kntc1 UTSW 5 123,902,254 (GRCm39) missense probably benign 0.02
R5496:Kntc1 UTSW 5 123,922,245 (GRCm39) missense probably benign 0.00
R5503:Kntc1 UTSW 5 123,957,939 (GRCm39) missense possibly damaging 0.81
R5633:Kntc1 UTSW 5 123,957,120 (GRCm39) missense probably damaging 0.99
R5638:Kntc1 UTSW 5 123,956,538 (GRCm39) missense possibly damaging 0.65
R5697:Kntc1 UTSW 5 123,903,070 (GRCm39) missense probably benign 0.00
R5757:Kntc1 UTSW 5 123,945,372 (GRCm39) critical splice donor site probably null
R5773:Kntc1 UTSW 5 123,932,220 (GRCm39) missense probably damaging 1.00
R5940:Kntc1 UTSW 5 123,924,258 (GRCm39) missense probably benign 0.05
R6019:Kntc1 UTSW 5 123,900,579 (GRCm39) missense probably benign 0.03
R6230:Kntc1 UTSW 5 123,927,072 (GRCm39) splice site probably null
R6437:Kntc1 UTSW 5 123,907,754 (GRCm39) missense probably damaging 0.98
R6888:Kntc1 UTSW 5 123,949,373 (GRCm39) missense probably damaging 1.00
R6907:Kntc1 UTSW 5 123,939,888 (GRCm39) missense probably damaging 1.00
R7123:Kntc1 UTSW 5 123,919,789 (GRCm39) missense probably damaging 1.00
R7262:Kntc1 UTSW 5 123,925,036 (GRCm39) missense probably benign 0.18
R7381:Kntc1 UTSW 5 123,948,971 (GRCm39) missense probably benign 0.12
R7485:Kntc1 UTSW 5 123,925,019 (GRCm39) missense possibly damaging 0.79
R7512:Kntc1 UTSW 5 123,929,001 (GRCm39) missense probably damaging 1.00
R7581:Kntc1 UTSW 5 123,954,818 (GRCm39) missense probably benign 0.05
R7687:Kntc1 UTSW 5 123,897,152 (GRCm39) missense probably benign 0.01
R7798:Kntc1 UTSW 5 123,957,180 (GRCm39) missense possibly damaging 0.94
R7798:Kntc1 UTSW 5 123,924,357 (GRCm39) missense probably benign
R7871:Kntc1 UTSW 5 123,922,290 (GRCm39) missense probably damaging 1.00
R7876:Kntc1 UTSW 5 123,913,850 (GRCm39) missense probably damaging 1.00
R7947:Kntc1 UTSW 5 123,919,951 (GRCm39) missense unknown
R7997:Kntc1 UTSW 5 123,916,117 (GRCm39) missense probably damaging 0.96
R8231:Kntc1 UTSW 5 123,920,959 (GRCm39) missense possibly damaging 0.47
R8257:Kntc1 UTSW 5 123,896,586 (GRCm39) critical splice donor site probably null
R8345:Kntc1 UTSW 5 123,924,993 (GRCm39) missense probably benign 0.37
R8354:Kntc1 UTSW 5 123,916,330 (GRCm39) missense probably damaging 1.00
R8732:Kntc1 UTSW 5 123,928,180 (GRCm39) missense probably benign 0.00
R8754:Kntc1 UTSW 5 123,897,115 (GRCm39) missense probably benign 0.01
R8947:Kntc1 UTSW 5 123,925,041 (GRCm39) missense probably benign 0.01
R9041:Kntc1 UTSW 5 123,927,093 (GRCm39) missense probably benign 0.00
R9182:Kntc1 UTSW 5 123,940,355 (GRCm39) missense probably damaging 1.00
R9432:Kntc1 UTSW 5 123,925,112 (GRCm39) missense possibly damaging 0.93
R9460:Kntc1 UTSW 5 123,941,378 (GRCm39) nonsense probably null
R9468:Kntc1 UTSW 5 123,954,776 (GRCm39) missense probably damaging 1.00
R9643:Kntc1 UTSW 5 123,949,440 (GRCm39) missense probably damaging 1.00
R9646:Kntc1 UTSW 5 123,897,119 (GRCm39) missense probably benign 0.01
R9789:Kntc1 UTSW 5 123,898,706 (GRCm39) missense possibly damaging 0.87
X0027:Kntc1 UTSW 5 123,948,992 (GRCm39) missense probably benign 0.00
X0065:Kntc1 UTSW 5 123,916,100 (GRCm39) nonsense probably null
X0067:Kntc1 UTSW 5 123,916,137 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCTAGCAGAGACTGTGAAGATTG -3'
(R):5'- AGCTTCGCGATTAAGAGCAG -3'

Sequencing Primer
(F):5'- CTGTGAAGATTGGGAAATGCATGC -3'
(R):5'- GACTCTTCGCTGAGCTCTGAG -3'
Posted On 2022-10-06