Mutagenetix > Incidental Mutation

Incidental Mutation 'R9721:Mphosph9'

730781

Institutional Source

Beutler Lab

Gene Symbol

Mphosph9

Ensembl Gene

ENSMUSG00000038126

Gene Name

M-phase phosphoprotein 9

Synonyms

MPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9721 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

124250959-124327972 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 124298675 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 535 (S535R)

Ref Sequence

ENSEMBL: ENSMUSP00000138982 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000130502] [ENSMUST00000141203] [ENSMUST00000147737] [ENSMUST00000184951]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031344
AA Change: S505R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126
AA Change: S505R

Domain	Start	End	E-Value	Type
low complexity region	102	119	N/A	INTRINSIC
low complexity region	128	140	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
coiled coil region	574	736	N/A	INTRINSIC
low complexity region	879	898	N/A	INTRINSIC
low complexity region	957	971	N/A	INTRINSIC
coiled coil region	1040	1105	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130502

SMART Domains

Protein: ENSMUSP00000120827
Gene: ENSMUSG00000038126

Domain	Start	End	E-Value	Type
low complexity region	47	74	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141203

Predicted Effect

probably benign
Transcript: ENSMUST00000147737

Predicted Effect

possibly damaging
Transcript: ENSMUST00000184951
AA Change: S535R

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: S535R

Domain	Start	End	E-Value	Type
coiled coil region	102	130	N/A	INTRINSIC
low complexity region	132	149	N/A	INTRINSIC
low complexity region	158	170	N/A	INTRINSIC
low complexity region	444	458	N/A	INTRINSIC
coiled coil region	604	766	N/A	INTRINSIC
low complexity region	909	928	N/A	INTRINSIC
low complexity region	987	1001	N/A	INTRINSIC
coiled coil region	1070	1135	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,419,283	Y120N	probably benign	Het
2410089E03Rik	A	G	15: 8,225,409	T27A	unknown	Het
4931428F04Rik	A	T	8: 105,283,188	D376E	probably benign	Het
AI314180	A	T	4: 58,850,938	S412T	probably benign	Het
Alox8	T	A	11: 69,197,085	H131L	probably benign	Het
Atp13a1	A	G	8: 69,799,437	E588G	probably damaging	Het
AU040320	G	A	4: 126,839,648	V654M	probably damaging	Het
Bicra	A	G	7: 15,979,176	L982P	probably damaging	Het
Cdh11	A	T	8: 102,679,625	V72E	probably damaging	Het
Cfap65	T	C	1: 74,919,342	T869A	probably benign	Het
Ddx19a	A	G	8: 110,978,475	F338S	probably damaging	Het
Dhrs7c	T	A	11: 67,815,078	V219E	probably damaging	Het
Dhx33	A	G	11: 71,001,598	V115A	probably damaging	Het
Dst	A	G	1: 34,192,785	D3153G	probably benign	Het
Eif5b	T	C	1: 38,037,659		probably null	Het
Ep300	A	G	15: 81,608,315	N284S	unknown	Het
Fam83a	A	G	15: 57,986,117	N19S	probably benign	Het
Fgd5	A	T	6: 91,988,297	T504S	probably benign	Het
Flt4	G	A	11: 49,644,433		probably null	Het
Ggta1	G	T	2: 35,413,406	D91E	probably benign	Het
Gls	A	G	1: 52,212,268	V310A	probably damaging	Het
Gm13178	A	T	4: 144,703,372	V349D	possibly damaging	Het
Gm5414	A	T	15: 101,628,147	C14*	probably null	Het
Gm906	T	C	13: 50,246,652	Y546C	possibly damaging	Het
Gm9887	C	G	12: 69,371,855	A202P	unknown	Het
Ifi214	T	C	1: 173,527,913	T110A	possibly damaging	Het
Il4i1	A	G	7: 44,839,689	R293G	probably benign	Het
Itpr1	A	T	6: 108,406,102	T1464S	probably damaging	Het
Kif18a	T	C	2: 109,293,055	S225P	probably damaging	Het
Kif21a	A	T	15: 90,971,127	I678N	probably damaging	Het
Klf11	T	A	12: 24,660,241	D429E	probably damaging	Het
Kntc1	A	G	5: 123,801,885	T1581A	probably benign	Het
Lama2	T	C	10: 27,467,342	N45D	possibly damaging	Het
Lrrk1	T	C	7: 66,274,875	I1319V	probably damaging	Het
Ltbr	G	A	6: 125,307,385	R365W	probably damaging	Het
Malrd1	C	T	2: 15,696,827	T751I	unknown	Het
Mgat5b	T	C	11: 116,966,769	L363P	probably damaging	Het
Nckap5	C	T	1: 126,027,280	D512N	probably damaging	Het
Ngef	T	A	1: 87,479,135	D637V	probably damaging	Het
Nup93	T	C	8: 94,303,685	Y391H	probably damaging	Het
Olfr1215	T	C	2: 89,001,716	T191A		Het
Olfr1406	C	A	1: 173,184,348	V29F	probably benign	Het
Olfr1469	A	T	19: 13,410,970	T134S	probably benign	Het
Pcdhb4	C	A	18: 37,309,852	D738E	possibly damaging	Het
Pfpl	G	C	19: 12,428,933	E183Q	probably damaging	Het
Phactr3	G	A	2: 178,256,250	E86K	probably damaging	Het
Psd	C	T	19: 46,323,189	D351N	probably benign	Het
Pzp	A	G	6: 128,495,191		probably null	Het
Rerg	T	A	6: 137,056,417	K106*	probably null	Het
Samd9l	T	C	6: 3,375,854	E469G	possibly damaging	Het
Smok2b	C	A	17: 13,234,978	Y8*	probably null	Het
Spn	A	G	7: 127,136,265	S357P	probably benign	Het
Tek	T	G	4: 94,804,302	W216G	possibly damaging	Het
Trpm3	A	T	19: 22,889,398	H531L	probably benign	Het
Trpm6	A	G	19: 18,829,972	M1027V	probably benign	Het
Tsc2	G	A	17: 24,599,642	R1408*	probably null	Het
Unc13b	A	G	4: 43,101,869	N155D	probably benign	Het
Vmn1r52	G	A	6: 90,179,026	C104Y	probably damaging	Het
Xylt1	A	T	7: 117,549,020	E273V	probably damaging	Het
Zc3h4	C	A	7: 16,434,845	Q1035K	unknown	Het
Zcchc11	T	A	4: 108,555,581	M1493K	probably benign	Het
Zfp14	A	T	7: 30,039,184	S125R	probably benign	Het

Other mutations in Mphosph9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Mphosph9	APN	5	124262021	missense	probably damaging	1.00
IGL01527:Mphosph9	APN	5	124283624	splice site	probably benign
IGL01784:Mphosph9	APN	5	124265310	splice site	probably benign
IGL01958:Mphosph9	APN	5	124324990	utr 5 prime	probably benign
IGL02020:Mphosph9	APN	5	124258950	missense	probably damaging	0.99
IGL02190:Mphosph9	APN	5	124265425	missense	possibly damaging	0.92
IGL02261:Mphosph9	APN	5	124260087	missense	probably damaging	1.00
IGL02569:Mphosph9	APN	5	124297571	nonsense	probably null
IGL02640:Mphosph9	APN	5	124315500	missense	possibly damaging	0.66
IGL02702:Mphosph9	APN	5	124259989	missense	probably damaging	1.00
IGL02793:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL02813:Mphosph9	APN	5	124315628	missense	probably benign	0.37
IGL02875:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL03149:Mphosph9	APN	5	124263011	missense	probably damaging	1.00
PIT4445001:Mphosph9	UTSW	5	124298790	missense	possibly damaging	0.82
R0304:Mphosph9	UTSW	5	124298829	missense	probably benign	0.01
R0437:Mphosph9	UTSW	5	124315568	missense	probably benign	0.27
R0483:Mphosph9	UTSW	5	124306970	nonsense	probably null
R0811:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0812:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0942:Mphosph9	UTSW	5	124262037	nonsense	probably null
R1175:Mphosph9	UTSW	5	124315676	missense	possibly damaging	0.94
R1372:Mphosph9	UTSW	5	124283745	splice site	probably null
R1442:Mphosph9	UTSW	5	124265398	missense	possibly damaging	0.62
R1533:Mphosph9	UTSW	5	124267141	missense	probably damaging	1.00
R1959:Mphosph9	UTSW	5	124315701	missense	possibly damaging	0.92
R2036:Mphosph9	UTSW	5	124304211	missense	probably damaging	0.97
R2256:Mphosph9	UTSW	5	124283659	missense	probably benign	0.00
R2919:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R2920:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R4064:Mphosph9	UTSW	5	124290917	missense	probably damaging	1.00
R4272:Mphosph9	UTSW	5	124304203	missense	probably damaging	0.96
R4430:Mphosph9	UTSW	5	124265446	missense	possibly damaging	0.83
R4883:Mphosph9	UTSW	5	124299045	missense	probably damaging	1.00
R4992:Mphosph9	UTSW	5	124304190	missense	probably damaging	1.00
R5815:Mphosph9	UTSW	5	124315418	missense	probably damaging	1.00
R5993:Mphosph9	UTSW	5	124316098	missense	probably benign	0.40
R6102:Mphosph9	UTSW	5	124297709	missense	possibly damaging	0.86
R6295:Mphosph9	UTSW	5	124320915	missense	possibly damaging	0.46
R6320:Mphosph9	UTSW	5	124324961	missense	probably damaging	0.99
R6628:Mphosph9	UTSW	5	124298762	missense	probably damaging	0.98
R6692:Mphosph9	UTSW	5	124260116	missense	probably damaging	1.00
R6705:Mphosph9	UTSW	5	124290964	missense	possibly damaging	0.83
R6747:Mphosph9	UTSW	5	124297699	missense	possibly damaging	0.93
R6787:Mphosph9	UTSW	5	124261027	missense	probably damaging	0.99
R6850:Mphosph9	UTSW	5	124260956	missense	probably damaging	1.00
R6956:Mphosph9	UTSW	5	124297558	missense	probably damaging	1.00
R7075:Mphosph9	UTSW	5	124320859	missense	probably damaging	0.99
R7604:Mphosph9	UTSW	5	124316117	missense	probably benign	0.01
R7789:Mphosph9	UTSW	5	124315587	missense	probably damaging	1.00
R7808:Mphosph9	UTSW	5	124260946	missense	probably damaging	0.99
R7823:Mphosph9	UTSW	5	124304256	missense	probably damaging	0.99
R7891:Mphosph9	UTSW	5	124290904	missense	probably damaging	1.00
R8210:Mphosph9	UTSW	5	124267111	missense	probably damaging	1.00
R8256:Mphosph9	UTSW	5	124255106	missense	probably damaging	1.00
R8385:Mphosph9	UTSW	5	124312722	missense	probably benign	0.19
R8438:Mphosph9	UTSW	5	124292392	missense	probably benign	0.19
R8692:Mphosph9	UTSW	5	124312812	missense	probably damaging	0.99
R8790:Mphosph9	UTSW	5	124315673	missense	probably damaging	1.00
R8818:Mphosph9	UTSW	5	124324964	nonsense	probably null
R8847:Mphosph9	UTSW	5	124316146	missense	possibly damaging	0.91
R9018:Mphosph9	UTSW	5	124298650	missense	probably benign	0.12
R9208:Mphosph9	UTSW	5	124312791	missense	probably damaging	0.97
R9221:Mphosph9	UTSW	5	124265364	missense	probably benign	0.10
R9603:Mphosph9	UTSW	5	124324952	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GATGCCTTTGTCAACACCTTTG -3'
(R):5'- CATCACCTGTGGACACTTGG -3'

Sequencing Primer
(F):5'- CCCAAGTACTGGCATTATAGGCATG -3'
(R):5'- CCTGTGGACACTTGGAAAAAC -3'

Posted On

2022-10-06