Incidental Mutation 'R9721:Samd9l'
ID 730782
Institutional Source Beutler Lab
Gene Symbol Samd9l
Ensembl Gene ENSMUSG00000047735
Gene Name sterile alpha motif domain containing 9-like
Synonyms ESTM25
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 3372257-3399571 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3375854 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 469 (E469G)
Ref Sequence ENSEMBL: ENSMUSP00000112688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000120087
AA Change: E469G

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: E469G

DomainStartEndE-ValueType
SCOP:d1kw4a_ 8 75 4e-8 SMART
Blast:SAM 11 75 1e-30 BLAST
low complexity region 96 115 N/A INTRINSIC
low complexity region 385 397 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201638
SMART Domains Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

DomainStartEndE-ValueType
Pfam:Ste50p-SAM 10 80 1.2e-8 PFAM
Pfam:SAM_2 11 68 8.7e-6 PFAM
Pfam:SAM_1 12 71 2.5e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,212,932 (GRCm39) Y120N probably benign Het
AAdacl4fm3 A T 4: 144,429,942 (GRCm39) V349D possibly damaging Het
Alox8 T A 11: 69,087,911 (GRCm39) H131L probably benign Het
Atp13a1 A G 8: 70,252,087 (GRCm39) E588G probably damaging Het
AU040320 G A 4: 126,733,441 (GRCm39) V654M probably damaging Het
Bicra A G 7: 15,713,101 (GRCm39) L982P probably damaging Het
Cdh11 A T 8: 103,406,257 (GRCm39) V72E probably damaging Het
Cfap65 T C 1: 74,958,501 (GRCm39) T869A probably benign Het
Cplane1 A G 15: 8,254,893 (GRCm39) T27A unknown Het
Ddx19a A G 8: 111,705,107 (GRCm39) F338S probably damaging Het
Dhrs7c T A 11: 67,705,904 (GRCm39) V219E probably damaging Het
Dhx33 A G 11: 70,892,424 (GRCm39) V115A probably damaging Het
Dst A G 1: 34,231,866 (GRCm39) D3153G probably benign Het
Ecpas A T 4: 58,850,938 (GRCm39) S412T probably benign Het
Eif5b T C 1: 38,076,740 (GRCm39) probably null Het
Ep300 A G 15: 81,492,516 (GRCm39) N284S unknown Het
Fam83a A G 15: 57,849,513 (GRCm39) N19S probably benign Het
Fgd5 A T 6: 91,965,278 (GRCm39) T504S probably benign Het
Flt4 G A 11: 49,535,260 (GRCm39) probably null Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Gls A G 1: 52,251,427 (GRCm39) V310A probably damaging Het
Gm5414 A T 15: 101,536,582 (GRCm39) C14* probably null Het
Gm9887 C G 12: 69,418,629 (GRCm39) A202P unknown Het
Ifi214 T C 1: 173,355,479 (GRCm39) T110A possibly damaging Het
Il4i1 A G 7: 44,489,113 (GRCm39) R293G probably benign Het
Itpr1 A T 6: 108,383,063 (GRCm39) T1464S probably damaging Het
Kif18a T C 2: 109,123,400 (GRCm39) S225P probably damaging Het
Kif21a A T 15: 90,855,330 (GRCm39) I678N probably damaging Het
Klf11 T A 12: 24,710,240 (GRCm39) D429E probably damaging Het
Kntc1 A G 5: 123,939,948 (GRCm39) T1581A probably benign Het
Lama2 T C 10: 27,343,338 (GRCm39) N45D possibly damaging Het
Lrrk1 T C 7: 65,924,623 (GRCm39) I1319V probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Malrd1 C T 2: 15,701,638 (GRCm39) T751I unknown Het
Matcap1 A T 8: 106,009,820 (GRCm39) D376E probably benign Het
Mgat5b T C 11: 116,857,595 (GRCm39) L363P probably damaging Het
Mphosph9 A T 5: 124,436,738 (GRCm39) S535R possibly damaging Het
Nckap5 C T 1: 125,955,017 (GRCm39) D512N probably damaging Het
Ngef T A 1: 87,406,857 (GRCm39) D637V probably damaging Het
Nup93 T C 8: 95,030,313 (GRCm39) Y391H probably damaging Het
Or10j7 C A 1: 173,011,915 (GRCm39) V29F probably benign Het
Or4c110 T C 2: 88,832,060 (GRCm39) T191A Het
Or5b3 A T 19: 13,388,334 (GRCm39) T134S probably benign Het
Pcdhb4 C A 18: 37,442,905 (GRCm39) D738E possibly damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Phactr3 G A 2: 177,898,043 (GRCm39) E86K probably damaging Het
Psd C T 19: 46,311,628 (GRCm39) D351N probably benign Het
Pzp A G 6: 128,472,154 (GRCm39) probably null Het
Rerg T A 6: 137,033,415 (GRCm39) K106* probably null Het
Smok2b C A 17: 13,453,865 (GRCm39) Y8* probably null Het
Spata31e3 T C 13: 50,400,688 (GRCm39) Y546C possibly damaging Het
Spn A G 7: 126,735,437 (GRCm39) S357P probably benign Het
Tek T G 4: 94,692,539 (GRCm39) W216G possibly damaging Het
Trpm3 A T 19: 22,866,762 (GRCm39) H531L probably benign Het
Trpm6 A G 19: 18,807,336 (GRCm39) M1027V probably benign Het
Tsc2 G A 17: 24,818,616 (GRCm39) R1408* probably null Het
Tut4 T A 4: 108,412,778 (GRCm39) M1493K probably benign Het
Unc13b A G 4: 43,101,869 (GRCm39) N155D probably benign Het
Vmn1r52 G A 6: 90,156,008 (GRCm39) C104Y probably damaging Het
Xylt1 A T 7: 117,148,255 (GRCm39) E273V probably damaging Het
Zc3h4 C A 7: 16,168,770 (GRCm39) Q1035K unknown Het
Zfp14 A T 7: 29,738,609 (GRCm39) S125R probably benign Het
Other mutations in Samd9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Samd9l APN 6 3,376,779 (GRCm39) missense probably damaging 0.96
IGL00550:Samd9l APN 6 3,374,594 (GRCm39) missense probably benign 0.00
IGL01100:Samd9l APN 6 3,375,863 (GRCm39) missense possibly damaging 0.91
IGL01321:Samd9l APN 6 3,376,259 (GRCm39) missense probably benign 0.42
IGL01553:Samd9l APN 6 3,375,566 (GRCm39) missense probably damaging 0.99
IGL01575:Samd9l APN 6 3,376,734 (GRCm39) missense possibly damaging 0.85
IGL01896:Samd9l APN 6 3,375,120 (GRCm39) missense probably benign 0.02
IGL01915:Samd9l APN 6 3,373,864 (GRCm39) nonsense probably null
IGL02063:Samd9l APN 6 3,372,992 (GRCm39) missense probably damaging 1.00
IGL02066:Samd9l APN 6 3,376,575 (GRCm39) missense probably damaging 1.00
IGL02145:Samd9l APN 6 3,374,105 (GRCm39) missense probably benign 0.13
IGL02163:Samd9l APN 6 3,374,246 (GRCm39) missense possibly damaging 0.90
IGL02256:Samd9l APN 6 3,376,197 (GRCm39) missense probably damaging 1.00
IGL02508:Samd9l APN 6 3,374,798 (GRCm39) missense probably damaging 1.00
IGL02591:Samd9l APN 6 3,375,760 (GRCm39) missense possibly damaging 0.91
IGL02968:Samd9l APN 6 3,376,026 (GRCm39) missense probably damaging 1.00
IGL03058:Samd9l APN 6 3,374,980 (GRCm39) missense probably damaging 0.99
IGL03068:Samd9l APN 6 3,375,348 (GRCm39) nonsense probably null
IGL03160:Samd9l APN 6 3,374,894 (GRCm39) missense probably damaging 1.00
IGL03372:Samd9l APN 6 3,375,314 (GRCm39) missense probably damaging 1.00
IGL03385:Samd9l APN 6 3,376,208 (GRCm39) missense probably damaging 0.99
boston_lager UTSW 6 3,375,761 (GRCm39) missense probably benign 0.12
ipa UTSW 6 3,376,347 (GRCm39) missense probably damaging 1.00
Paine UTSW 6 3,372,716 (GRCm39) missense probably damaging 0.99
samad UTSW 6 3,374,032 (GRCm39) nonsense probably null
IGL03054:Samd9l UTSW 6 3,376,023 (GRCm39) missense probably damaging 1.00
R0111:Samd9l UTSW 6 3,374,946 (GRCm39) missense possibly damaging 0.80
R0112:Samd9l UTSW 6 3,376,031 (GRCm39) missense possibly damaging 0.93
R0356:Samd9l UTSW 6 3,375,107 (GRCm39) missense possibly damaging 0.69
R0370:Samd9l UTSW 6 3,377,264 (GRCm39) start gained probably benign
R0398:Samd9l UTSW 6 3,374,502 (GRCm39) missense probably damaging 1.00
R0744:Samd9l UTSW 6 3,372,725 (GRCm39) missense possibly damaging 0.92
R0833:Samd9l UTSW 6 3,372,725 (GRCm39) missense possibly damaging 0.92
R0880:Samd9l UTSW 6 3,377,064 (GRCm39) missense probably damaging 0.99
R1110:Samd9l UTSW 6 3,374,267 (GRCm39) missense probably benign 0.44
R1155:Samd9l UTSW 6 3,376,939 (GRCm39) missense probably benign 0.01
R1268:Samd9l UTSW 6 3,376,113 (GRCm39) missense possibly damaging 0.56
R1293:Samd9l UTSW 6 3,373,947 (GRCm39) missense possibly damaging 0.93
R1478:Samd9l UTSW 6 3,376,369 (GRCm39) missense probably benign 0.06
R1573:Samd9l UTSW 6 3,375,426 (GRCm39) missense probably damaging 0.99
R1590:Samd9l UTSW 6 3,375,761 (GRCm39) missense probably benign 0.12
R1611:Samd9l UTSW 6 3,373,771 (GRCm39) missense probably benign 0.00
R1754:Samd9l UTSW 6 3,373,126 (GRCm39) missense probably damaging 0.96
R1759:Samd9l UTSW 6 3,373,401 (GRCm39) missense probably damaging 1.00
R1795:Samd9l UTSW 6 3,375,264 (GRCm39) nonsense probably null
R1829:Samd9l UTSW 6 3,375,107 (GRCm39) missense possibly damaging 0.69
R1935:Samd9l UTSW 6 3,376,269 (GRCm39) missense probably benign 0.01
R2154:Samd9l UTSW 6 3,372,945 (GRCm39) missense possibly damaging 0.91
R2228:Samd9l UTSW 6 3,376,910 (GRCm39) missense probably benign 0.08
R3622:Samd9l UTSW 6 3,374,032 (GRCm39) nonsense probably null
R3903:Samd9l UTSW 6 3,376,830 (GRCm39) nonsense probably null
R3904:Samd9l UTSW 6 3,376,830 (GRCm39) nonsense probably null
R3945:Samd9l UTSW 6 3,377,029 (GRCm39) missense possibly damaging 0.71
R4091:Samd9l UTSW 6 3,376,887 (GRCm39) missense probably benign 0.22
R4602:Samd9l UTSW 6 3,373,937 (GRCm39) frame shift probably null
R4602:Samd9l UTSW 6 3,373,935 (GRCm39) missense probably damaging 1.00
R4618:Samd9l UTSW 6 3,376,347 (GRCm39) missense probably damaging 1.00
R4747:Samd9l UTSW 6 3,375,504 (GRCm39) nonsense probably null
R4762:Samd9l UTSW 6 3,375,623 (GRCm39) missense probably benign 0.01
R4814:Samd9l UTSW 6 3,372,863 (GRCm39) missense probably damaging 0.98
R4934:Samd9l UTSW 6 3,375,621 (GRCm39) nonsense probably null
R5026:Samd9l UTSW 6 3,375,284 (GRCm39) missense possibly damaging 0.75
R5048:Samd9l UTSW 6 3,374,157 (GRCm39) missense probably benign 0.35
R5130:Samd9l UTSW 6 3,374,548 (GRCm39) missense possibly damaging 0.69
R5271:Samd9l UTSW 6 3,376,156 (GRCm39) missense probably benign 0.02
R5328:Samd9l UTSW 6 3,376,739 (GRCm39) missense probably damaging 0.99
R5507:Samd9l UTSW 6 3,373,898 (GRCm39) missense possibly damaging 0.78
R5587:Samd9l UTSW 6 3,373,291 (GRCm39) missense possibly damaging 0.84
R5846:Samd9l UTSW 6 3,376,754 (GRCm39) missense probably benign
R5881:Samd9l UTSW 6 3,372,716 (GRCm39) missense possibly damaging 0.70
R5889:Samd9l UTSW 6 3,376,460 (GRCm39) missense probably damaging 1.00
R6131:Samd9l UTSW 6 3,377,252 (GRCm39) missense probably benign 0.00
R6199:Samd9l UTSW 6 3,376,686 (GRCm39) missense probably benign 0.13
R6298:Samd9l UTSW 6 3,375,383 (GRCm39) missense probably damaging 1.00
R6331:Samd9l UTSW 6 3,376,361 (GRCm39) missense probably damaging 1.00
R6489:Samd9l UTSW 6 3,376,896 (GRCm39) missense probably benign
R6601:Samd9l UTSW 6 3,377,229 (GRCm39) missense possibly damaging 0.74
R6655:Samd9l UTSW 6 3,377,247 (GRCm39) missense probably benign 0.22
R6803:Samd9l UTSW 6 3,375,446 (GRCm39) missense probably damaging 0.97
R6864:Samd9l UTSW 6 3,374,750 (GRCm39) missense probably benign 0.14
R6905:Samd9l UTSW 6 3,375,387 (GRCm39) missense probably damaging 0.99
R6919:Samd9l UTSW 6 3,376,313 (GRCm39) missense possibly damaging 0.88
R7060:Samd9l UTSW 6 3,372,716 (GRCm39) missense probably damaging 0.99
R7073:Samd9l UTSW 6 3,375,856 (GRCm39) nonsense probably null
R7250:Samd9l UTSW 6 3,374,201 (GRCm39) missense possibly damaging 0.78
R7307:Samd9l UTSW 6 3,372,600 (GRCm39) nonsense probably null
R7351:Samd9l UTSW 6 3,374,157 (GRCm39) missense probably benign 0.35
R7423:Samd9l UTSW 6 3,374,408 (GRCm39) missense probably damaging 1.00
R7610:Samd9l UTSW 6 3,376,754 (GRCm39) missense probably benign
R7667:Samd9l UTSW 6 3,375,975 (GRCm39) missense possibly damaging 0.87
R7672:Samd9l UTSW 6 3,373,646 (GRCm39) missense probably benign 0.16
R7680:Samd9l UTSW 6 3,376,469 (GRCm39) missense probably damaging 1.00
R7680:Samd9l UTSW 6 3,372,569 (GRCm39) missense probably damaging 1.00
R7814:Samd9l UTSW 6 3,374,793 (GRCm39) missense possibly damaging 0.86
R7829:Samd9l UTSW 6 3,374,749 (GRCm39) missense probably benign 0.00
R8000:Samd9l UTSW 6 3,373,034 (GRCm39) missense probably damaging 1.00
R8098:Samd9l UTSW 6 3,375,549 (GRCm39) missense probably damaging 1.00
R8698:Samd9l UTSW 6 3,373,843 (GRCm39) missense probably benign 0.06
R8785:Samd9l UTSW 6 3,377,064 (GRCm39) missense probably damaging 0.99
R8795:Samd9l UTSW 6 3,374,221 (GRCm39) nonsense probably null
R8806:Samd9l UTSW 6 3,376,665 (GRCm39) missense probably damaging 0.99
R8832:Samd9l UTSW 6 3,374,990 (GRCm39) missense probably damaging 1.00
R8954:Samd9l UTSW 6 3,374,577 (GRCm39) missense probably damaging 0.98
R9023:Samd9l UTSW 6 3,373,791 (GRCm39) missense probably damaging 1.00
R9051:Samd9l UTSW 6 3,373,493 (GRCm39) missense probably benign 0.16
R9108:Samd9l UTSW 6 3,373,104 (GRCm39) missense possibly damaging 0.71
R9213:Samd9l UTSW 6 3,376,856 (GRCm39) missense probably benign 0.23
R9494:Samd9l UTSW 6 3,375,830 (GRCm39) missense possibly damaging 0.51
R9504:Samd9l UTSW 6 3,372,621 (GRCm39) missense probably benign 0.17
R9655:Samd9l UTSW 6 3,373,578 (GRCm39) missense probably benign 0.00
R9688:Samd9l UTSW 6 3,377,087 (GRCm39) missense probably damaging 1.00
R9696:Samd9l UTSW 6 3,375,078 (GRCm39) missense possibly damaging 0.76
X0026:Samd9l UTSW 6 3,375,560 (GRCm39) missense probably damaging 1.00
X0066:Samd9l UTSW 6 3,374,477 (GRCm39) missense probably damaging 1.00
Z1176:Samd9l UTSW 6 3,376,770 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCTGTGAGGAATGAAATAAGTC -3'
(R):5'- ACAGCGTCTAGAAAAGCGGC -3'

Sequencing Primer
(F):5'- GGAATGAAATAAGTCTTCTAACCCC -3'
(R):5'- TGTCTAAACTTTTGACCAGACACC -3'
Posted On 2022-10-06