Mutagenetix > Incidental Mutation

Incidental Mutation 'R9721:Samd9l'

730782

Institutional Source

Beutler Lab

Gene Symbol

Samd9l

Ensembl Gene

ENSMUSG00000047735

Gene Name

sterile alpha motif domain containing 9-like

Synonyms

ESTM25

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9721 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3372257-3399572 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3375854 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 469 (E469G)

Ref Sequence

ENSEMBL: ENSMUSP00000112688 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120087
AA Change: E469G

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: E469G

Domain	Start	End	E-Value	Type
SCOP:d1kw4a_	8	75	4e-8	SMART
Blast:SAM	11	75	1e-30	BLAST
low complexity region	96	115	N/A	INTRINSIC
low complexity region	385	397	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201638

SMART Domains

Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

Domain	Start	End	E-Value	Type
Pfam:Ste50p-SAM	10	80	1.2e-8	PFAM
Pfam:SAM_2	11	68	8.7e-6	PFAM
Pfam:SAM_1	12	71	2.5e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,419,283	Y120N	probably benign	Het
2410089E03Rik	A	G	15: 8,225,409	T27A	unknown	Het
4931428F04Rik	A	T	8: 105,283,188	D376E	probably benign	Het
AI314180	A	T	4: 58,850,938	S412T	probably benign	Het
Alox8	T	A	11: 69,197,085	H131L	probably benign	Het
Atp13a1	A	G	8: 69,799,437	E588G	probably damaging	Het
AU040320	G	A	4: 126,839,648	V654M	probably damaging	Het
Bicra	A	G	7: 15,979,176	L982P	probably damaging	Het
Cdh11	A	T	8: 102,679,625	V72E	probably damaging	Het
Cfap65	T	C	1: 74,919,342	T869A	probably benign	Het
Ddx19a	A	G	8: 110,978,475	F338S	probably damaging	Het
Dhrs7c	T	A	11: 67,815,078	V219E	probably damaging	Het
Dhx33	A	G	11: 71,001,598	V115A	probably damaging	Het
Dst	A	G	1: 34,192,785	D3153G	probably benign	Het
Eif5b	T	C	1: 38,037,659		probably null	Het
Ep300	A	G	15: 81,608,315	N284S	unknown	Het
Fam83a	A	G	15: 57,986,117	N19S	probably benign	Het
Fgd5	A	T	6: 91,988,297	T504S	probably benign	Het
Flt4	G	A	11: 49,644,433		probably null	Het
Ggta1	G	T	2: 35,413,406	D91E	probably benign	Het
Gls	A	G	1: 52,212,268	V310A	probably damaging	Het
Gm13178	A	T	4: 144,703,372	V349D	possibly damaging	Het
Gm5414	A	T	15: 101,628,147	C14*	probably null	Het
Gm906	T	C	13: 50,246,652	Y546C	possibly damaging	Het
Gm9887	C	G	12: 69,371,855	A202P	unknown	Het
Ifi214	T	C	1: 173,527,913	T110A	possibly damaging	Het
Il4i1	A	G	7: 44,839,689	R293G	probably benign	Het
Itpr1	A	T	6: 108,406,102	T1464S	probably damaging	Het
Kif18a	T	C	2: 109,293,055	S225P	probably damaging	Het
Kif21a	A	T	15: 90,971,127	I678N	probably damaging	Het
Klf11	T	A	12: 24,660,241	D429E	probably damaging	Het
Kntc1	A	G	5: 123,801,885	T1581A	probably benign	Het
Lama2	T	C	10: 27,467,342	N45D	possibly damaging	Het
Lrrk1	T	C	7: 66,274,875	I1319V	probably damaging	Het
Ltbr	G	A	6: 125,307,385	R365W	probably damaging	Het
Malrd1	C	T	2: 15,696,827	T751I	unknown	Het
Mgat5b	T	C	11: 116,966,769	L363P	probably damaging	Het
Mphosph9	A	T	5: 124,298,675	S535R	possibly damaging	Het
Nckap5	C	T	1: 126,027,280	D512N	probably damaging	Het
Ngef	T	A	1: 87,479,135	D637V	probably damaging	Het
Nup93	T	C	8: 94,303,685	Y391H	probably damaging	Het
Olfr1215	T	C	2: 89,001,716	T191A		Het
Olfr1406	C	A	1: 173,184,348	V29F	probably benign	Het
Olfr1469	A	T	19: 13,410,970	T134S	probably benign	Het
Pcdhb4	C	A	18: 37,309,852	D738E	possibly damaging	Het
Pfpl	G	C	19: 12,428,933	E183Q	probably damaging	Het
Phactr3	G	A	2: 178,256,250	E86K	probably damaging	Het
Psd	C	T	19: 46,323,189	D351N	probably benign	Het
Pzp	A	G	6: 128,495,191		probably null	Het
Rerg	T	A	6: 137,056,417	K106*	probably null	Het
Smok2b	C	A	17: 13,234,978	Y8*	probably null	Het
Spn	A	G	7: 127,136,265	S357P	probably benign	Het
Tek	T	G	4: 94,804,302	W216G	possibly damaging	Het
Trpm3	A	T	19: 22,889,398	H531L	probably benign	Het
Trpm6	A	G	19: 18,829,972	M1027V	probably benign	Het
Tsc2	G	A	17: 24,599,642	R1408*	probably null	Het
Unc13b	A	G	4: 43,101,869	N155D	probably benign	Het
Vmn1r52	G	A	6: 90,179,026	C104Y	probably damaging	Het
Xylt1	A	T	7: 117,549,020	E273V	probably damaging	Het
Zc3h4	C	A	7: 16,434,845	Q1035K	unknown	Het
Zcchc11	T	A	4: 108,555,581	M1493K	probably benign	Het
Zfp14	A	T	7: 30,039,184	S125R	probably benign	Het

Other mutations in Samd9l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Samd9l	APN	6	3376779	missense	probably damaging	0.96
IGL00550:Samd9l	APN	6	3374594	missense	probably benign	0.00
IGL01100:Samd9l	APN	6	3375863	missense	possibly damaging	0.91
IGL01321:Samd9l	APN	6	3376259	missense	probably benign	0.42
IGL01553:Samd9l	APN	6	3375566	missense	probably damaging	0.99
IGL01575:Samd9l	APN	6	3376734	missense	possibly damaging	0.85
IGL01896:Samd9l	APN	6	3375120	missense	probably benign	0.02
IGL01915:Samd9l	APN	6	3373864	nonsense	probably null
IGL02063:Samd9l	APN	6	3372992	missense	probably damaging	1.00
IGL02066:Samd9l	APN	6	3376575	missense	probably damaging	1.00
IGL02145:Samd9l	APN	6	3374105	missense	probably benign	0.13
IGL02163:Samd9l	APN	6	3374246	missense	possibly damaging	0.90
IGL02256:Samd9l	APN	6	3376197	missense	probably damaging	1.00
IGL02508:Samd9l	APN	6	3374798	missense	probably damaging	1.00
IGL02591:Samd9l	APN	6	3375760	missense	possibly damaging	0.91
IGL02968:Samd9l	APN	6	3376026	missense	probably damaging	1.00
IGL03058:Samd9l	APN	6	3374980	missense	probably damaging	0.99
IGL03068:Samd9l	APN	6	3375348	nonsense	probably null
IGL03160:Samd9l	APN	6	3374894	missense	probably damaging	1.00
IGL03372:Samd9l	APN	6	3375314	missense	probably damaging	1.00
IGL03385:Samd9l	APN	6	3376208	missense	probably damaging	0.99
boston_lager	UTSW	6	3375761	missense	probably benign	0.12
ipa	UTSW	6	3376347	missense	probably damaging	1.00
Paine	UTSW	6	3372716	missense	probably damaging	0.99
samad	UTSW	6	3374032	nonsense	probably null
IGL03054:Samd9l	UTSW	6	3376023	missense	probably damaging	1.00
R0111:Samd9l	UTSW	6	3374946	missense	possibly damaging	0.80
R0112:Samd9l	UTSW	6	3376031	missense	possibly damaging	0.93
R0356:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R0370:Samd9l	UTSW	6	3377264	start gained	probably benign
R0398:Samd9l	UTSW	6	3374502	missense	probably damaging	1.00
R0744:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0833:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0880:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R1110:Samd9l	UTSW	6	3374267	missense	probably benign	0.44
R1155:Samd9l	UTSW	6	3376939	missense	probably benign	0.01
R1268:Samd9l	UTSW	6	3376113	missense	possibly damaging	0.56
R1293:Samd9l	UTSW	6	3373947	missense	possibly damaging	0.93
R1478:Samd9l	UTSW	6	3376369	missense	probably benign	0.06
R1573:Samd9l	UTSW	6	3375426	missense	probably damaging	0.99
R1590:Samd9l	UTSW	6	3375761	missense	probably benign	0.12
R1611:Samd9l	UTSW	6	3373771	missense	probably benign	0.00
R1754:Samd9l	UTSW	6	3373126	missense	probably damaging	0.96
R1759:Samd9l	UTSW	6	3373401	missense	probably damaging	1.00
R1795:Samd9l	UTSW	6	3375264	nonsense	probably null
R1829:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R1935:Samd9l	UTSW	6	3376269	missense	probably benign	0.01
R2154:Samd9l	UTSW	6	3372945	missense	possibly damaging	0.91
R2228:Samd9l	UTSW	6	3376910	missense	probably benign	0.08
R3622:Samd9l	UTSW	6	3374032	nonsense	probably null
R3903:Samd9l	UTSW	6	3376830	nonsense	probably null
R3904:Samd9l	UTSW	6	3376830	nonsense	probably null
R3945:Samd9l	UTSW	6	3377029	missense	possibly damaging	0.71
R4091:Samd9l	UTSW	6	3376887	missense	probably benign	0.22
R4602:Samd9l	UTSW	6	3373935	missense	probably damaging	1.00
R4602:Samd9l	UTSW	6	3373937	frame shift	probably null
R4618:Samd9l	UTSW	6	3376347	missense	probably damaging	1.00
R4747:Samd9l	UTSW	6	3375504	nonsense	probably null
R4762:Samd9l	UTSW	6	3375623	missense	probably benign	0.01
R4814:Samd9l	UTSW	6	3372863	missense	probably damaging	0.98
R4934:Samd9l	UTSW	6	3375621	nonsense	probably null
R5026:Samd9l	UTSW	6	3375284	missense	possibly damaging	0.75
R5048:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R5130:Samd9l	UTSW	6	3374548	missense	possibly damaging	0.69
R5271:Samd9l	UTSW	6	3376156	missense	probably benign	0.02
R5328:Samd9l	UTSW	6	3376739	missense	probably damaging	0.99
R5507:Samd9l	UTSW	6	3373898	missense	possibly damaging	0.78
R5587:Samd9l	UTSW	6	3373291	missense	possibly damaging	0.84
R5846:Samd9l	UTSW	6	3376754	missense	probably benign
R5881:Samd9l	UTSW	6	3372716	missense	possibly damaging	0.70
R5889:Samd9l	UTSW	6	3376460	missense	probably damaging	1.00
R6131:Samd9l	UTSW	6	3377252	missense	probably benign	0.00
R6199:Samd9l	UTSW	6	3376686	missense	probably benign	0.13
R6298:Samd9l	UTSW	6	3375383	missense	probably damaging	1.00
R6331:Samd9l	UTSW	6	3376361	missense	probably damaging	1.00
R6489:Samd9l	UTSW	6	3376896	missense	probably benign
R6601:Samd9l	UTSW	6	3377229	missense	possibly damaging	0.74
R6655:Samd9l	UTSW	6	3377247	missense	probably benign	0.22
R6803:Samd9l	UTSW	6	3375446	missense	probably damaging	0.97
R6864:Samd9l	UTSW	6	3374750	missense	probably benign	0.14
R6905:Samd9l	UTSW	6	3375387	missense	probably damaging	0.99
R6919:Samd9l	UTSW	6	3376313	missense	possibly damaging	0.88
R7060:Samd9l	UTSW	6	3372716	missense	probably damaging	0.99
R7073:Samd9l	UTSW	6	3375856	nonsense	probably null
R7250:Samd9l	UTSW	6	3374201	missense	possibly damaging	0.78
R7307:Samd9l	UTSW	6	3372600	nonsense	probably null
R7351:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R7423:Samd9l	UTSW	6	3374408	missense	probably damaging	1.00
R7610:Samd9l	UTSW	6	3376754	missense	probably benign
R7667:Samd9l	UTSW	6	3375975	missense	possibly damaging	0.87
R7672:Samd9l	UTSW	6	3373646	missense	probably benign	0.16
R7680:Samd9l	UTSW	6	3372569	missense	probably damaging	1.00
R7680:Samd9l	UTSW	6	3376469	missense	probably damaging	1.00
R7814:Samd9l	UTSW	6	3374793	missense	possibly damaging	0.86
R7829:Samd9l	UTSW	6	3374749	missense	probably benign	0.00
R8000:Samd9l	UTSW	6	3373034	missense	probably damaging	1.00
R8098:Samd9l	UTSW	6	3375549	missense	probably damaging	1.00
R8698:Samd9l	UTSW	6	3373843	missense	probably benign	0.06
R8785:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R8795:Samd9l	UTSW	6	3374221	nonsense	probably null
R8806:Samd9l	UTSW	6	3376665	missense	probably damaging	0.99
R8832:Samd9l	UTSW	6	3374990	missense	probably damaging	1.00
R8954:Samd9l	UTSW	6	3374577	missense	probably damaging	0.98
R9023:Samd9l	UTSW	6	3373791	missense	probably damaging	1.00
R9051:Samd9l	UTSW	6	3373493	missense	probably benign	0.16
R9108:Samd9l	UTSW	6	3373104	missense	possibly damaging	0.71
R9213:Samd9l	UTSW	6	3376856	missense	probably benign	0.23
R9494:Samd9l	UTSW	6	3375830	missense	possibly damaging	0.51
R9504:Samd9l	UTSW	6	3372621	missense	probably benign	0.17
R9655:Samd9l	UTSW	6	3373578	missense	probably benign	0.00
R9688:Samd9l	UTSW	6	3377087	missense	probably damaging	1.00
R9696:Samd9l	UTSW	6	3375078	missense	possibly damaging	0.76
X0026:Samd9l	UTSW	6	3375560	missense	probably damaging	1.00
X0066:Samd9l	UTSW	6	3374477	missense	probably damaging	1.00
Z1176:Samd9l	UTSW	6	3376770	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTCTGTGAGGAATGAAATAAGTC -3'
(R):5'- ACAGCGTCTAGAAAAGCGGC -3'

Sequencing Primer
(F):5'- GGAATGAAATAAGTCTTCTAACCCC -3'
(R):5'- TGTCTAAACTTTTGACCAGACACC -3'

Posted On

2022-10-06