Incidental Mutation 'R9721:Bicra'
ID 730789
Institutional Source Beutler Lab
Gene Symbol Bicra
Ensembl Gene ENSMUSG00000070808
Gene Name BRD4 interacting chromatin remodeling complex associated protein
Synonyms Gltscr1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.176) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 15704597-15781846 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 15713101 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 982 (L982P)
Ref Sequence ENSEMBL: ENSMUSP00000092416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094821] [ENSMUST00000210781]
AlphaFold F8VPZ9
Predicted Effect probably damaging
Transcript: ENSMUST00000094821
AA Change: L982P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092416
Gene: ENSMUSG00000070808
AA Change: L982P

DomainStartEndE-ValueType
low complexity region 86 96 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
internal_repeat_1 156 298 1.03e-6 PROSPERO
low complexity region 308 323 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
internal_repeat_1 479 614 1.03e-6 PROSPERO
low complexity region 619 638 N/A INTRINSIC
low complexity region 642 676 N/A INTRINSIC
low complexity region 719 732 N/A INTRINSIC
low complexity region 756 782 N/A INTRINSIC
low complexity region 790 819 N/A INTRINSIC
low complexity region 827 843 N/A INTRINSIC
low complexity region 852 906 N/A INTRINSIC
low complexity region 940 950 N/A INTRINSIC
low complexity region 987 1006 N/A INTRINSIC
Pfam:GLTSCR1 1094 1202 4.6e-43 PFAM
low complexity region 1232 1251 N/A INTRINSIC
low complexity region 1275 1294 N/A INTRINSIC
low complexity region 1349 1371 N/A INTRINSIC
low complexity region 1460 1473 N/A INTRINSIC
low complexity region 1535 1555 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210781
AA Change: L982P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,212,932 (GRCm39) Y120N probably benign Het
AAdacl4fm3 A T 4: 144,429,942 (GRCm39) V349D possibly damaging Het
Alox8 T A 11: 69,087,911 (GRCm39) H131L probably benign Het
Atp13a1 A G 8: 70,252,087 (GRCm39) E588G probably damaging Het
AU040320 G A 4: 126,733,441 (GRCm39) V654M probably damaging Het
Cdh11 A T 8: 103,406,257 (GRCm39) V72E probably damaging Het
Cfap65 T C 1: 74,958,501 (GRCm39) T869A probably benign Het
Cplane1 A G 15: 8,254,893 (GRCm39) T27A unknown Het
Ddx19a A G 8: 111,705,107 (GRCm39) F338S probably damaging Het
Dhrs7c T A 11: 67,705,904 (GRCm39) V219E probably damaging Het
Dhx33 A G 11: 70,892,424 (GRCm39) V115A probably damaging Het
Dst A G 1: 34,231,866 (GRCm39) D3153G probably benign Het
Ecpas A T 4: 58,850,938 (GRCm39) S412T probably benign Het
Eif5b T C 1: 38,076,740 (GRCm39) probably null Het
Ep300 A G 15: 81,492,516 (GRCm39) N284S unknown Het
Fam83a A G 15: 57,849,513 (GRCm39) N19S probably benign Het
Fgd5 A T 6: 91,965,278 (GRCm39) T504S probably benign Het
Flt4 G A 11: 49,535,260 (GRCm39) probably null Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Gls A G 1: 52,251,427 (GRCm39) V310A probably damaging Het
Gm5414 A T 15: 101,536,582 (GRCm39) C14* probably null Het
Gm9887 C G 12: 69,418,629 (GRCm39) A202P unknown Het
Ifi214 T C 1: 173,355,479 (GRCm39) T110A possibly damaging Het
Il4i1 A G 7: 44,489,113 (GRCm39) R293G probably benign Het
Itpr1 A T 6: 108,383,063 (GRCm39) T1464S probably damaging Het
Kif18a T C 2: 109,123,400 (GRCm39) S225P probably damaging Het
Kif21a A T 15: 90,855,330 (GRCm39) I678N probably damaging Het
Klf11 T A 12: 24,710,240 (GRCm39) D429E probably damaging Het
Kntc1 A G 5: 123,939,948 (GRCm39) T1581A probably benign Het
Lama2 T C 10: 27,343,338 (GRCm39) N45D possibly damaging Het
Lrrk1 T C 7: 65,924,623 (GRCm39) I1319V probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Malrd1 C T 2: 15,701,638 (GRCm39) T751I unknown Het
Matcap1 A T 8: 106,009,820 (GRCm39) D376E probably benign Het
Mgat5b T C 11: 116,857,595 (GRCm39) L363P probably damaging Het
Mphosph9 A T 5: 124,436,738 (GRCm39) S535R possibly damaging Het
Nckap5 C T 1: 125,955,017 (GRCm39) D512N probably damaging Het
Ngef T A 1: 87,406,857 (GRCm39) D637V probably damaging Het
Nup93 T C 8: 95,030,313 (GRCm39) Y391H probably damaging Het
Or10j7 C A 1: 173,011,915 (GRCm39) V29F probably benign Het
Or4c110 T C 2: 88,832,060 (GRCm39) T191A Het
Or5b3 A T 19: 13,388,334 (GRCm39) T134S probably benign Het
Pcdhb4 C A 18: 37,442,905 (GRCm39) D738E possibly damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Phactr3 G A 2: 177,898,043 (GRCm39) E86K probably damaging Het
Psd C T 19: 46,311,628 (GRCm39) D351N probably benign Het
Pzp A G 6: 128,472,154 (GRCm39) probably null Het
Rerg T A 6: 137,033,415 (GRCm39) K106* probably null Het
Samd9l T C 6: 3,375,854 (GRCm39) E469G possibly damaging Het
Smok2b C A 17: 13,453,865 (GRCm39) Y8* probably null Het
Spata31e3 T C 13: 50,400,688 (GRCm39) Y546C possibly damaging Het
Spn A G 7: 126,735,437 (GRCm39) S357P probably benign Het
Tek T G 4: 94,692,539 (GRCm39) W216G possibly damaging Het
Trpm3 A T 19: 22,866,762 (GRCm39) H531L probably benign Het
Trpm6 A G 19: 18,807,336 (GRCm39) M1027V probably benign Het
Tsc2 G A 17: 24,818,616 (GRCm39) R1408* probably null Het
Tut4 T A 4: 108,412,778 (GRCm39) M1493K probably benign Het
Unc13b A G 4: 43,101,869 (GRCm39) N155D probably benign Het
Vmn1r52 G A 6: 90,156,008 (GRCm39) C104Y probably damaging Het
Xylt1 A T 7: 117,148,255 (GRCm39) E273V probably damaging Het
Zc3h4 C A 7: 16,168,770 (GRCm39) Q1035K unknown Het
Zfp14 A T 7: 29,738,609 (GRCm39) S125R probably benign Het
Other mutations in Bicra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Bicra APN 7 15,730,502 (GRCm39) missense possibly damaging 0.70
IGL01521:Bicra APN 7 15,723,113 (GRCm39) missense probably benign 0.18
IGL01690:Bicra APN 7 15,721,678 (GRCm39) missense probably benign 0.09
IGL01721:Bicra APN 7 15,722,624 (GRCm39) missense probably benign
IGL01994:Bicra APN 7 15,706,741 (GRCm39) missense possibly damaging 0.46
IGL02084:Bicra APN 7 15,721,663 (GRCm39) missense probably benign 0.09
IGL02312:Bicra APN 7 15,727,066 (GRCm39) missense possibly damaging 0.85
IGL02686:Bicra APN 7 15,721,840 (GRCm39) missense probably benign 0.02
IGL02727:Bicra APN 7 15,713,390 (GRCm39) missense possibly damaging 0.95
IGL03031:Bicra APN 7 15,709,726 (GRCm39) missense probably benign 0.16
R0003:Bicra UTSW 7 15,705,812 (GRCm39) missense probably benign
R0025:Bicra UTSW 7 15,721,436 (GRCm39) missense possibly damaging 0.53
R0241:Bicra UTSW 7 15,709,070 (GRCm39) missense probably damaging 1.00
R0241:Bicra UTSW 7 15,709,070 (GRCm39) missense probably damaging 1.00
R0417:Bicra UTSW 7 15,706,247 (GRCm39) missense probably damaging 1.00
R0437:Bicra UTSW 7 15,722,687 (GRCm39) missense possibly damaging 0.73
R0547:Bicra UTSW 7 15,706,173 (GRCm39) missense probably damaging 1.00
R0688:Bicra UTSW 7 15,723,247 (GRCm39) missense probably damaging 1.00
R0855:Bicra UTSW 7 15,705,929 (GRCm39) missense probably damaging 1.00
R1448:Bicra UTSW 7 15,722,284 (GRCm39) missense possibly damaging 0.86
R1637:Bicra UTSW 7 15,706,614 (GRCm39) missense probably benign 0.19
R1899:Bicra UTSW 7 15,721,676 (GRCm39) missense possibly damaging 0.53
R2035:Bicra UTSW 7 15,730,338 (GRCm39) missense possibly damaging 0.53
R2247:Bicra UTSW 7 15,723,159 (GRCm39) missense probably benign 0.33
R2471:Bicra UTSW 7 15,706,257 (GRCm39) missense probably benign 0.04
R2484:Bicra UTSW 7 15,722,605 (GRCm39) missense possibly damaging 0.96
R3437:Bicra UTSW 7 15,723,223 (GRCm39) missense possibly damaging 0.85
R3551:Bicra UTSW 7 15,713,658 (GRCm39) missense probably benign 0.33
R4816:Bicra UTSW 7 15,722,831 (GRCm39) missense possibly damaging 0.53
R4901:Bicra UTSW 7 15,721,526 (GRCm39) missense possibly damaging 0.53
R5035:Bicra UTSW 7 15,713,349 (GRCm39) missense possibly damaging 0.90
R5078:Bicra UTSW 7 15,709,382 (GRCm39) missense probably damaging 1.00
R5094:Bicra UTSW 7 15,709,296 (GRCm39) missense probably damaging 1.00
R5195:Bicra UTSW 7 15,713,878 (GRCm39) missense possibly damaging 0.93
R5496:Bicra UTSW 7 15,721,766 (GRCm39) missense probably benign 0.33
R5780:Bicra UTSW 7 15,713,679 (GRCm39) missense possibly damaging 0.96
R6541:Bicra UTSW 7 15,713,054 (GRCm39) missense probably benign 0.00
R6560:Bicra UTSW 7 15,723,119 (GRCm39) missense possibly damaging 0.53
R6575:Bicra UTSW 7 15,713,056 (GRCm39) missense probably benign 0.25
R6854:Bicra UTSW 7 15,722,687 (GRCm39) missense probably benign 0.18
R6967:Bicra UTSW 7 15,706,130 (GRCm39) missense probably damaging 0.97
R7283:Bicra UTSW 7 15,706,425 (GRCm39) missense probably damaging 1.00
R7454:Bicra UTSW 7 15,706,059 (GRCm39) missense probably benign 0.30
R7462:Bicra UTSW 7 15,713,060 (GRCm39) missense possibly damaging 0.84
R7488:Bicra UTSW 7 15,723,367 (GRCm39) critical splice acceptor site probably null
R7506:Bicra UTSW 7 15,722,138 (GRCm39) missense possibly damaging 0.96
R7534:Bicra UTSW 7 15,705,860 (GRCm39) missense probably damaging 0.98
R7915:Bicra UTSW 7 15,722,447 (GRCm39) missense probably benign
R8063:Bicra UTSW 7 15,712,969 (GRCm39) missense probably benign
R8147:Bicra UTSW 7 15,722,395 (GRCm39) missense possibly damaging 0.93
R8699:Bicra UTSW 7 15,723,113 (GRCm39) missense probably benign 0.18
R8784:Bicra UTSW 7 15,705,875 (GRCm39) missense probably damaging 1.00
R8859:Bicra UTSW 7 15,721,737 (GRCm39) missense possibly damaging 0.73
R8971:Bicra UTSW 7 15,721,481 (GRCm39) missense probably benign 0.08
R9487:Bicra UTSW 7 15,705,717 (GRCm39) missense probably damaging 0.99
R9614:Bicra UTSW 7 15,705,880 (GRCm39) missense probably damaging 1.00
R9777:Bicra UTSW 7 15,705,987 (GRCm39) missense probably benign 0.09
X0064:Bicra UTSW 7 15,709,700 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGTACCAGCAGAGTAGGG -3'
(R):5'- GATTCCACCAGGTAACCATCAG -3'

Sequencing Primer
(F):5'- ACGACCCCTTTGCCTAGG -3'
(R):5'- AGGTAACCATCAGCAGCG -3'
Posted On 2022-10-06