Mutagenetix > Incidental Mutation

Incidental Mutation 'R9721:Lrrk1'

730793

Institutional Source

Beutler Lab

Gene Symbol

Lrrk1

Ensembl Gene

ENSMUSG00000015133

Gene Name

leucine-rich repeat kinase 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9721 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

66226912-66388350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66274875 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1319 (I1319V)

Ref Sequence

ENSEMBL: ENSMUSP00000015277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015277] [ENSMUST00000145954]

AlphaFold

Q3UHC2

Predicted Effect

probably damaging
Transcript: ENSMUST00000015277
AA Change: I1319V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: I1319V

Domain	Start	End	E-Value	Type
ANK	86	116	9.33e2	SMART
ANK	119	148	1.14e2	SMART
ANK	152	182	8.36e1	SMART
ANK	193	223	2.6e1	SMART
LRR	278	300	2.84e2	SMART
LRR	301	325	7.79e0	SMART
LRR	328	351	3.27e1	SMART
LRR_TYP	379	401	2.53e-2	SMART
LRR	403	427	5.89e1	SMART
LRR	472	493	5.27e1	SMART
LRR	548	569	2.92e2	SMART
LRR	570	594	5.88e0	SMART
Pfam:Arf	625	786	2e-8	PFAM
Pfam:Roc	640	761	3.1e-24	PFAM
Pfam:Ras	640	782	2.2e-7	PFAM
Pfam:COR	844	1046	4.7e-26	PFAM
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1209	1222	N/A	INTRINSIC
Pfam:Pkinase	1243	1521	7.8e-40	PFAM
Pfam:Pkinase_Tyr	1244	1520	9.4e-39	PFAM
low complexity region	1642	1654	N/A	INTRINSIC
low complexity region	1839	1846	N/A	INTRINSIC
low complexity region	1852	1871	N/A	INTRINSIC
low complexity region	1957	1970	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000145954
AA Change: I234V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114938
Gene: ENSMUSG00000015133
AA Change: I234V

Domain	Start	End	E-Value	Type
low complexity region	24	34	N/A	INTRINSIC
low complexity region	124	137	N/A	INTRINSIC
Pfam:Pkinase	158	435	6.6e-46	PFAM
Pfam:Pkinase_Tyr	159	435	5.8e-40	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,419,283	Y120N	probably benign	Het
2410089E03Rik	A	G	15: 8,225,409	T27A	unknown	Het
4931428F04Rik	A	T	8: 105,283,188	D376E	probably benign	Het
AI314180	A	T	4: 58,850,938	S412T	probably benign	Het
Alox8	T	A	11: 69,197,085	H131L	probably benign	Het
Atp13a1	A	G	8: 69,799,437	E588G	probably damaging	Het
AU040320	G	A	4: 126,839,648	V654M	probably damaging	Het
Bicra	A	G	7: 15,979,176	L982P	probably damaging	Het
Cdh11	A	T	8: 102,679,625	V72E	probably damaging	Het
Cfap65	T	C	1: 74,919,342	T869A	probably benign	Het
Ddx19a	A	G	8: 110,978,475	F338S	probably damaging	Het
Dhrs7c	T	A	11: 67,815,078	V219E	probably damaging	Het
Dhx33	A	G	11: 71,001,598	V115A	probably damaging	Het
Dst	A	G	1: 34,192,785	D3153G	probably benign	Het
Eif5b	T	C	1: 38,037,659		probably null	Het
Ep300	A	G	15: 81,608,315	N284S	unknown	Het
Fam83a	A	G	15: 57,986,117	N19S	probably benign	Het
Fgd5	A	T	6: 91,988,297	T504S	probably benign	Het
Flt4	G	A	11: 49,644,433		probably null	Het
Ggta1	G	T	2: 35,413,406	D91E	probably benign	Het
Gls	A	G	1: 52,212,268	V310A	probably damaging	Het
Gm13178	A	T	4: 144,703,372	V349D	possibly damaging	Het
Gm5414	A	T	15: 101,628,147	C14*	probably null	Het
Gm906	T	C	13: 50,246,652	Y546C	possibly damaging	Het
Gm9887	C	G	12: 69,371,855	A202P	unknown	Het
Ifi214	T	C	1: 173,527,913	T110A	possibly damaging	Het
Il4i1	A	G	7: 44,839,689	R293G	probably benign	Het
Itpr1	A	T	6: 108,406,102	T1464S	probably damaging	Het
Kif18a	T	C	2: 109,293,055	S225P	probably damaging	Het
Kif21a	A	T	15: 90,971,127	I678N	probably damaging	Het
Klf11	T	A	12: 24,660,241	D429E	probably damaging	Het
Kntc1	A	G	5: 123,801,885	T1581A	probably benign	Het
Lama2	T	C	10: 27,467,342	N45D	possibly damaging	Het
Ltbr	G	A	6: 125,307,385	R365W	probably damaging	Het
Malrd1	C	T	2: 15,696,827	T751I	unknown	Het
Mgat5b	T	C	11: 116,966,769	L363P	probably damaging	Het
Mphosph9	A	T	5: 124,298,675	S535R	possibly damaging	Het
Nckap5	C	T	1: 126,027,280	D512N	probably damaging	Het
Ngef	T	A	1: 87,479,135	D637V	probably damaging	Het
Nup93	T	C	8: 94,303,685	Y391H	probably damaging	Het
Olfr1215	T	C	2: 89,001,716	T191A		Het
Olfr1406	C	A	1: 173,184,348	V29F	probably benign	Het
Olfr1469	A	T	19: 13,410,970	T134S	probably benign	Het
Pcdhb4	C	A	18: 37,309,852	D738E	possibly damaging	Het
Pfpl	G	C	19: 12,428,933	E183Q	probably damaging	Het
Phactr3	G	A	2: 178,256,250	E86K	probably damaging	Het
Psd	C	T	19: 46,323,189	D351N	probably benign	Het
Pzp	A	G	6: 128,495,191		probably null	Het
Rerg	T	A	6: 137,056,417	K106*	probably null	Het
Samd9l	T	C	6: 3,375,854	E469G	possibly damaging	Het
Smok2b	C	A	17: 13,234,978	Y8*	probably null	Het
Spn	A	G	7: 127,136,265	S357P	probably benign	Het
Tek	T	G	4: 94,804,302	W216G	possibly damaging	Het
Trpm3	A	T	19: 22,889,398	H531L	probably benign	Het
Trpm6	A	G	19: 18,829,972	M1027V	probably benign	Het
Tsc2	G	A	17: 24,599,642	R1408*	probably null	Het
Unc13b	A	G	4: 43,101,869	N155D	probably benign	Het
Vmn1r52	G	A	6: 90,179,026	C104Y	probably damaging	Het
Xylt1	A	T	7: 117,549,020	E273V	probably damaging	Het
Zc3h4	C	A	7: 16,434,845	Q1035K	unknown	Het
Zcchc11	T	A	4: 108,555,581	M1493K	probably benign	Het
Zfp14	A	T	7: 30,039,184	S125R	probably benign	Het

Other mutations in Lrrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lrrk1	APN	7	66287701	missense	probably damaging	1.00
IGL01511:Lrrk1	APN	7	66265450	missense	possibly damaging	0.48
IGL02337:Lrrk1	APN	7	66279416	missense	possibly damaging	0.92
IGL02636:Lrrk1	APN	7	66308659	critical splice donor site	probably null
IGL02679:Lrrk1	APN	7	66274872	missense	probably damaging	1.00
IGL02711:Lrrk1	APN	7	66330767	missense	probably damaging	1.00
IGL02742:Lrrk1	APN	7	66308691	missense	probably benign	0.12
IGL02878:Lrrk1	APN	7	66262563	missense	probably benign
IGL03135:Lrrk1	APN	7	66262890	missense	probably benign	0.00
IGL03191:Lrrk1	APN	7	66259959	missense	probably damaging	0.99
IGL03198:Lrrk1	APN	7	66306894	missense	probably damaging	1.00
combustion	UTSW	7	66262665	missense	possibly damaging	0.94
fluorine	UTSW	7	66302710	missense	possibly damaging	0.89
halide	UTSW	7	66265474	missense	possibly damaging	0.82
Heiland	UTSW	7	66262733	missense	probably damaging	0.96
liebster	UTSW	7	66294981	missense	probably damaging	1.00
magi	UTSW	7	66281648	missense	probably damaging	1.00
oxidation	UTSW	7	66279372	missense	probably benign	0.00
phlogiston	UTSW	7	66278520	splice site	probably benign
Savior	UTSW	7	66262487	missense	probably damaging	1.00
wenig	UTSW	7	66273001	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0276:Lrrk1	UTSW	7	66296263	splice site	probably benign
R0505:Lrrk1	UTSW	7	66290908	splice site	probably null
R0609:Lrrk1	UTSW	7	66266615	splice site	probably null
R0650:Lrrk1	UTSW	7	66292336	missense	probably damaging	1.00
R0676:Lrrk1	UTSW	7	66294981	missense	probably damaging	1.00
R1157:Lrrk1	UTSW	7	66262283	missense	probably benign	0.00
R1435:Lrrk1	UTSW	7	66273028	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1498:Lrrk1	UTSW	7	66302671	nonsense	probably null
R1620:Lrrk1	UTSW	7	66381538	missense	probably benign	0.00
R1884:Lrrk1	UTSW	7	66262437	missense	probably benign
R1891:Lrrk1	UTSW	7	66279300	missense	probably damaging	1.00
R1989:Lrrk1	UTSW	7	66281684	missense	probably damaging	1.00
R2107:Lrrk1	UTSW	7	66279282	missense	probably damaging	1.00
R2140:Lrrk1	UTSW	7	66330750	missense	probably damaging	1.00
R2144:Lrrk1	UTSW	7	66296163	missense	probably damaging	0.98
R2147:Lrrk1	UTSW	7	66285411	splice site	probably null
R3176:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3276:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3886:Lrrk1	UTSW	7	66292364	missense	probably damaging	1.00
R3893:Lrrk1	UTSW	7	66278520	splice site	probably benign
R3906:Lrrk1	UTSW	7	66294903	missense	possibly damaging	0.84
R4259:Lrrk1	UTSW	7	66330764	missense	probably damaging	1.00
R4649:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4653:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4672:Lrrk1	UTSW	7	66279372	missense	probably benign	0.00
R4693:Lrrk1	UTSW	7	66262487	missense	probably damaging	1.00
R4729:Lrrk1	UTSW	7	66262293	missense	probably benign
R4737:Lrrk1	UTSW	7	66306873	missense	probably benign	0.09
R4795:Lrrk1	UTSW	7	66262665	missense	possibly damaging	0.94
R4911:Lrrk1	UTSW	7	66295454	missense	probably damaging	0.97
R5002:Lrrk1	UTSW	7	66332363	missense	probably damaging	1.00
R5254:Lrrk1	UTSW	7	66307107	missense	probably benign	0.00
R5407:Lrrk1	UTSW	7	66270797	missense	probably benign	0.20
R5482:Lrrk1	UTSW	7	66330670	missense	probably benign
R5600:Lrrk1	UTSW	7	66307215	missense	probably benign	0.31
R5615:Lrrk1	UTSW	7	66287615	missense	probably damaging	1.00
R6041:Lrrk1	UTSW	7	66262133	missense	probably benign
R6211:Lrrk1	UTSW	7	66302710	missense	possibly damaging	0.89
R6271:Lrrk1	UTSW	7	66307103	critical splice donor site	probably null
R6276:Lrrk1	UTSW	7	66306839	splice site	probably null
R6447:Lrrk1	UTSW	7	66302728	missense	probably benign	0.19
R6478:Lrrk1	UTSW	7	66262733	missense	probably damaging	0.96
R6615:Lrrk1	UTSW	7	66281648	missense	probably damaging	1.00
R6745:Lrrk1	UTSW	7	66273001	missense	probably damaging	1.00
R6836:Lrrk1	UTSW	7	66342779	missense	probably benign	0.05
R6995:Lrrk1	UTSW	7	66292342	missense	probably damaging	1.00
R7107:Lrrk1	UTSW	7	66287443	missense	possibly damaging	0.94
R7137:Lrrk1	UTSW	7	66285279	missense	probably benign	0.06
R7203:Lrrk1	UTSW	7	66270825	missense	probably damaging	1.00
R7224:Lrrk1	UTSW	7	66332386	missense	probably damaging	0.99
R7239:Lrrk1	UTSW	7	66262155	missense	probably benign
R7440:Lrrk1	UTSW	7	66290854	missense	probably damaging	1.00
R7515:Lrrk1	UTSW	7	66262562	missense	probably benign
R7593:Lrrk1	UTSW	7	66308691	missense	probably benign	0.12
R7728:Lrrk1	UTSW	7	66262715	missense	probably benign	0.00
R7984:Lrrk1	UTSW	7	66300729	splice site	probably null
R7993:Lrrk1	UTSW	7	66262454	missense	probably benign	0.00
R8009:Lrrk1	UTSW	7	66265474	missense	possibly damaging	0.82
R8037:Lrrk1	UTSW	7	66285341	missense	probably benign
R8101:Lrrk1	UTSW	7	66342782	missense	probably benign
R8116:Lrrk1	UTSW	7	66262623	missense	possibly damaging	0.95
R8126:Lrrk1	UTSW	7	66292315	missense	probably damaging	1.00
R8278:Lrrk1	UTSW	7	66278684	missense	probably benign	0.37
R8559:Lrrk1	UTSW	7	66282327	missense	possibly damaging	0.48
R8669:Lrrk1	UTSW	7	66262596	missense	probably benign	0.20
R8690:Lrrk1	UTSW	7	66302729	missense	probably benign	0.02
R8955:Lrrk1	UTSW	7	66269825	missense	probably benign	0.09
R9135:Lrrk1	UTSW	7	66278609	missense	probably damaging	1.00
R9380:Lrrk1	UTSW	7	66278583	missense	probably damaging	1.00
R9625:Lrrk1	UTSW	7	66259918	makesense	probably null
RF018:Lrrk1	UTSW	7	66381502	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GCCTTTGGCTCAACGAAAC -3'
(R):5'- TACCTTGCCTTAGGTCCAGC -3'

Sequencing Primer
(F):5'- TTTTGCAAGAGAGCCATGTGAG -3'
(R):5'- AGCAGGGAGGCCGCAAC -3'

Posted On

2022-10-06