Mutagenetix > Incidental Mutation

Incidental Mutation 'R9721:Nup93'

730797

Institutional Source

Beutler Lab

Gene Symbol

Nup93

Ensembl Gene

ENSMUSG00000032939

Gene Name

nucleoporin 93

Synonyms

2410008G02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.914) question?

Stock #

R9721 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

94214564-94317227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 94303685 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 391 (Y391H)

Ref Sequence

ENSEMBL: ENSMUSP00000078878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000211822] [ENSMUST00000212824]

AlphaFold

Q8BJ71

Predicted Effect

probably damaging
Transcript: ENSMUST00000079961
AA Change: Y391H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939
AA Change: Y391H

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	42	52	N/A	INTRINSIC
Pfam:Nic96	214	804	6.9e-198	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109547
AA Change: Y391H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939
AA Change: Y391H

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	42	52	N/A	INTRINSIC
Pfam:Nic96	202	804	8.2e-202	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000211822
AA Change: Y268H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212824
AA Change: Y391H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,419,283	Y120N	probably benign	Het
2410089E03Rik	A	G	15: 8,225,409	T27A	unknown	Het
4931428F04Rik	A	T	8: 105,283,188	D376E	probably benign	Het
AI314180	A	T	4: 58,850,938	S412T	probably benign	Het
Alox8	T	A	11: 69,197,085	H131L	probably benign	Het
Atp13a1	A	G	8: 69,799,437	E588G	probably damaging	Het
AU040320	G	A	4: 126,839,648	V654M	probably damaging	Het
Bicra	A	G	7: 15,979,176	L982P	probably damaging	Het
Cdh11	A	T	8: 102,679,625	V72E	probably damaging	Het
Cfap65	T	C	1: 74,919,342	T869A	probably benign	Het
Ddx19a	A	G	8: 110,978,475	F338S	probably damaging	Het
Dhrs7c	T	A	11: 67,815,078	V219E	probably damaging	Het
Dhx33	A	G	11: 71,001,598	V115A	probably damaging	Het
Dst	A	G	1: 34,192,785	D3153G	probably benign	Het
Eif5b	T	C	1: 38,037,659		probably null	Het
Ep300	A	G	15: 81,608,315	N284S	unknown	Het
Fam83a	A	G	15: 57,986,117	N19S	probably benign	Het
Fgd5	A	T	6: 91,988,297	T504S	probably benign	Het
Flt4	G	A	11: 49,644,433		probably null	Het
Ggta1	G	T	2: 35,413,406	D91E	probably benign	Het
Gls	A	G	1: 52,212,268	V310A	probably damaging	Het
Gm13178	A	T	4: 144,703,372	V349D	possibly damaging	Het
Gm5414	A	T	15: 101,628,147	C14*	probably null	Het
Gm906	T	C	13: 50,246,652	Y546C	possibly damaging	Het
Gm9887	C	G	12: 69,371,855	A202P	unknown	Het
Ifi214	T	C	1: 173,527,913	T110A	possibly damaging	Het
Il4i1	A	G	7: 44,839,689	R293G	probably benign	Het
Itpr1	A	T	6: 108,406,102	T1464S	probably damaging	Het
Kif18a	T	C	2: 109,293,055	S225P	probably damaging	Het
Kif21a	A	T	15: 90,971,127	I678N	probably damaging	Het
Klf11	T	A	12: 24,660,241	D429E	probably damaging	Het
Kntc1	A	G	5: 123,801,885	T1581A	probably benign	Het
Lama2	T	C	10: 27,467,342	N45D	possibly damaging	Het
Lrrk1	T	C	7: 66,274,875	I1319V	probably damaging	Het
Ltbr	G	A	6: 125,307,385	R365W	probably damaging	Het
Malrd1	C	T	2: 15,696,827	T751I	unknown	Het
Mgat5b	T	C	11: 116,966,769	L363P	probably damaging	Het
Mphosph9	A	T	5: 124,298,675	S535R	possibly damaging	Het
Nckap5	C	T	1: 126,027,280	D512N	probably damaging	Het
Ngef	T	A	1: 87,479,135	D637V	probably damaging	Het
Olfr1215	T	C	2: 89,001,716	T191A		Het
Olfr1406	C	A	1: 173,184,348	V29F	probably benign	Het
Olfr1469	A	T	19: 13,410,970	T134S	probably benign	Het
Pcdhb4	C	A	18: 37,309,852	D738E	possibly damaging	Het
Pfpl	G	C	19: 12,428,933	E183Q	probably damaging	Het
Phactr3	G	A	2: 178,256,250	E86K	probably damaging	Het
Psd	C	T	19: 46,323,189	D351N	probably benign	Het
Pzp	A	G	6: 128,495,191		probably null	Het
Rerg	T	A	6: 137,056,417	K106*	probably null	Het
Samd9l	T	C	6: 3,375,854	E469G	possibly damaging	Het
Smok2b	C	A	17: 13,234,978	Y8*	probably null	Het
Spn	A	G	7: 127,136,265	S357P	probably benign	Het
Tek	T	G	4: 94,804,302	W216G	possibly damaging	Het
Trpm3	A	T	19: 22,889,398	H531L	probably benign	Het
Trpm6	A	G	19: 18,829,972	M1027V	probably benign	Het
Tsc2	G	A	17: 24,599,642	R1408*	probably null	Het
Unc13b	A	G	4: 43,101,869	N155D	probably benign	Het
Vmn1r52	G	A	6: 90,179,026	C104Y	probably damaging	Het
Xylt1	A	T	7: 117,549,020	E273V	probably damaging	Het
Zc3h4	C	A	7: 16,434,845	Q1035K	unknown	Het
Zcchc11	T	A	4: 108,555,581	M1493K	probably benign	Het
Zfp14	A	T	7: 30,039,184	S125R	probably benign	Het

Other mutations in Nup93

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00783:Nup93	APN	8	94309023	critical splice donor site	probably null
IGL01652:Nup93	APN	8	94296559	missense	possibly damaging	0.93
IGL02003:Nup93	APN	8	94302109	nonsense	probably null
IGL02169:Nup93	APN	8	94302129	missense	probably damaging	1.00
IGL02212:Nup93	APN	8	94311662	critical splice donor site	probably null
IGL02551:Nup93	APN	8	94227833	nonsense	probably null
IGL02568:Nup93	APN	8	94309635	missense	probably damaging	1.00
IGL03094:Nup93	APN	8	94296502	missense	probably benign
IGL03248:Nup93	APN	8	94306088	missense	probably damaging	0.98
IGL03273:Nup93	APN	8	94306277	missense	probably benign	0.01
IGL03401:Nup93	APN	8	94309711	splice site	probably null
PIT4585001:Nup93	UTSW	8	94243727	missense	probably benign	0.25
R0409:Nup93	UTSW	8	94303665	missense	probably damaging	1.00
R0748:Nup93	UTSW	8	94307943	missense	probably damaging	1.00
R0891:Nup93	UTSW	8	94281263	splice site	probably benign
R1667:Nup93	UTSW	8	94292687	missense	possibly damaging	0.71
R1696:Nup93	UTSW	8	94296555	missense	probably benign	0.29
R1862:Nup93	UTSW	8	94306102	missense	probably damaging	1.00
R2069:Nup93	UTSW	8	94243739	missense	probably damaging	1.00
R2143:Nup93	UTSW	8	94296480	nonsense	probably null
R2187:Nup93	UTSW	8	94300850	missense	probably damaging	1.00
R2228:Nup93	UTSW	8	94304191	missense	probably benign	0.27
R2229:Nup93	UTSW	8	94304191	missense	probably benign	0.27
R2254:Nup93	UTSW	8	94227857	critical splice donor site	probably null
R2884:Nup93	UTSW	8	94303638	missense	probably damaging	1.00
R4521:Nup93	UTSW	8	94314636	missense	probably damaging	1.00
R4563:Nup93	UTSW	8	94307892	missense	probably damaging	1.00
R4900:Nup93	UTSW	8	94286603	missense	probably benign	0.25
R5570:Nup93	UTSW	8	94314670	missense	probably damaging	1.00
R6226:Nup93	UTSW	8	94286537	missense	probably damaging	1.00
R6489:Nup93	UTSW	8	94302088	missense	probably benign	0.10
R6658:Nup93	UTSW	8	94304179	missense	probably benign	0.02
R6817:Nup93	UTSW	8	94314682	critical splice donor site	probably null
R6895:Nup93	UTSW	8	94243686	missense	probably damaging	1.00
R6955:Nup93	UTSW	8	94309673	missense	probably damaging	0.96
R7476:Nup93	UTSW	8	94303632	missense	probably damaging	1.00
R7643:Nup93	UTSW	8	94286619	critical splice donor site	probably null
R7994:Nup93	UTSW	8	94306302	missense	probably benign	0.15
R8461:Nup93	UTSW	8	94281335	critical splice donor site	probably null
R9177:Nup93	UTSW	8	94227743	missense	probably benign	0.25
R9264:Nup93	UTSW	8	94292720	missense	probably benign	0.01
R9532:Nup93	UTSW	8	94314621	missense	probably damaging	1.00
R9567:Nup93	UTSW	8	94308976	missense	possibly damaging	0.94
R9629:Nup93	UTSW	8	94306639	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCTAGCAATTAGAAGTCAGGTG -3'
(R):5'- ACTGTCCCTGTCCTGAGTAC -3'

Sequencing Primer
(F):5'- AGAGAGGCCCTGTGCTCAG -3'
(R):5'- GTCCTGAGTACTACACAAACTTCATG -3'

Posted On

2022-10-06