Incidental Mutation 'R9721:Cdh11'
ID 730798
Institutional Source Beutler Lab
Gene Symbol Cdh11
Ensembl Gene ENSMUSG00000031673
Gene Name cadherin 11
Synonyms osteoblast-cadherin, Cad11, OB-cadherin
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 102632095-102785642 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102679625 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 72 (V72E)
Ref Sequence ENSEMBL: ENSMUSP00000074681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075190]
AlphaFold P55288
PDB Structure Crystal structure of mouse cadherin-11 EC1 [X-RAY DIFFRACTION]
Crystal structure of mouse cadherin-11 EC1-2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000075190
AA Change: V72E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074681
Gene: ENSMUSG00000031673
AA Change: V72E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 76 157 1.99e-19 SMART
CA 181 266 3.33e-30 SMART
CA 290 382 3.37e-17 SMART
CA 405 486 1.14e-23 SMART
CA 513 600 4.77e-8 SMART
transmembrane domain 618 640 N/A INTRINSIC
Pfam:Cadherin_C 643 788 1.1e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a type II classical cadherin and preproprotein that is proteolytically processed to generate a mature protein product. This protein product is an integral membrane protein that mediates calcium-dependent cell-cell adhesion, specifically in the context of bone development. Homozygous knockout mice for this gene exhibit impaired synovium development and reduced bone density. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutant animals appear healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,419,283 Y120N probably benign Het
2410089E03Rik A G 15: 8,225,409 T27A unknown Het
4931428F04Rik A T 8: 105,283,188 D376E probably benign Het
AI314180 A T 4: 58,850,938 S412T probably benign Het
Alox8 T A 11: 69,197,085 H131L probably benign Het
Atp13a1 A G 8: 69,799,437 E588G probably damaging Het
AU040320 G A 4: 126,839,648 V654M probably damaging Het
Bicra A G 7: 15,979,176 L982P probably damaging Het
Cfap65 T C 1: 74,919,342 T869A probably benign Het
Ddx19a A G 8: 110,978,475 F338S probably damaging Het
Dhrs7c T A 11: 67,815,078 V219E probably damaging Het
Dhx33 A G 11: 71,001,598 V115A probably damaging Het
Dst A G 1: 34,192,785 D3153G probably benign Het
Eif5b T C 1: 38,037,659 probably null Het
Ep300 A G 15: 81,608,315 N284S unknown Het
Fam83a A G 15: 57,986,117 N19S probably benign Het
Fgd5 A T 6: 91,988,297 T504S probably benign Het
Flt4 G A 11: 49,644,433 probably null Het
Ggta1 G T 2: 35,413,406 D91E probably benign Het
Gls A G 1: 52,212,268 V310A probably damaging Het
Gm13178 A T 4: 144,703,372 V349D possibly damaging Het
Gm5414 A T 15: 101,628,147 C14* probably null Het
Gm906 T C 13: 50,246,652 Y546C possibly damaging Het
Gm9887 C G 12: 69,371,855 A202P unknown Het
Ifi214 T C 1: 173,527,913 T110A possibly damaging Het
Il4i1 A G 7: 44,839,689 R293G probably benign Het
Itpr1 A T 6: 108,406,102 T1464S probably damaging Het
Kif18a T C 2: 109,293,055 S225P probably damaging Het
Kif21a A T 15: 90,971,127 I678N probably damaging Het
Klf11 T A 12: 24,660,241 D429E probably damaging Het
Kntc1 A G 5: 123,801,885 T1581A probably benign Het
Lama2 T C 10: 27,467,342 N45D possibly damaging Het
Lrrk1 T C 7: 66,274,875 I1319V probably damaging Het
Ltbr G A 6: 125,307,385 R365W probably damaging Het
Malrd1 C T 2: 15,696,827 T751I unknown Het
Mgat5b T C 11: 116,966,769 L363P probably damaging Het
Mphosph9 A T 5: 124,298,675 S535R possibly damaging Het
Nckap5 C T 1: 126,027,280 D512N probably damaging Het
Ngef T A 1: 87,479,135 D637V probably damaging Het
Nup93 T C 8: 94,303,685 Y391H probably damaging Het
Olfr1215 T C 2: 89,001,716 T191A Het
Olfr1406 C A 1: 173,184,348 V29F probably benign Het
Olfr1469 A T 19: 13,410,970 T134S probably benign Het
Pcdhb4 C A 18: 37,309,852 D738E possibly damaging Het
Pfpl G C 19: 12,428,933 E183Q probably damaging Het
Phactr3 G A 2: 178,256,250 E86K probably damaging Het
Psd C T 19: 46,323,189 D351N probably benign Het
Pzp A G 6: 128,495,191 probably null Het
Rerg T A 6: 137,056,417 K106* probably null Het
Samd9l T C 6: 3,375,854 E469G possibly damaging Het
Smok2b C A 17: 13,234,978 Y8* probably null Het
Spn A G 7: 127,136,265 S357P probably benign Het
Tek T G 4: 94,804,302 W216G possibly damaging Het
Trpm3 A T 19: 22,889,398 H531L probably benign Het
Trpm6 A G 19: 18,829,972 M1027V probably benign Het
Tsc2 G A 17: 24,599,642 R1408* probably null Het
Unc13b A G 4: 43,101,869 N155D probably benign Het
Vmn1r52 G A 6: 90,179,026 C104Y probably damaging Het
Xylt1 A T 7: 117,549,020 E273V probably damaging Het
Zc3h4 C A 7: 16,434,845 Q1035K unknown Het
Zcchc11 T A 4: 108,555,581 M1493K probably benign Het
Zfp14 A T 7: 30,039,184 S125R probably benign Het
Other mutations in Cdh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Cdh11 APN 8 102650649 missense probably damaging 1.00
IGL01019:Cdh11 APN 8 102679745 missense probably benign
IGL01286:Cdh11 APN 8 102664629 missense probably damaging 0.98
IGL01556:Cdh11 APN 8 102679644 missense probably damaging 1.00
IGL01964:Cdh11 APN 8 102664743 missense probably benign 0.03
IGL02322:Cdh11 APN 8 102647519 missense probably benign 0.01
IGL03094:Cdh11 APN 8 102658403 missense probably benign
IGL03110:Cdh11 APN 8 102673870 missense probably damaging 1.00
IGL03391:Cdh11 APN 8 102674023 missense possibly damaging 0.89
R0401:Cdh11 UTSW 8 102674006 missense probably damaging 1.00
R0466:Cdh11 UTSW 8 102670058 missense possibly damaging 0.89
R0731:Cdh11 UTSW 8 102668019 missense probably damaging 1.00
R0925:Cdh11 UTSW 8 102634724 missense probably damaging 1.00
R1597:Cdh11 UTSW 8 102650711 missense probably benign 0.06
R1624:Cdh11 UTSW 8 102664601 splice site probably benign
R1829:Cdh11 UTSW 8 102634641 missense possibly damaging 0.92
R2029:Cdh11 UTSW 8 102679772 missense probably benign 0.00
R4191:Cdh11 UTSW 8 102650748 missense probably damaging 0.98
R4270:Cdh11 UTSW 8 102664626 missense possibly damaging 0.69
R4271:Cdh11 UTSW 8 102664626 missense possibly damaging 0.69
R4455:Cdh11 UTSW 8 102647823 missense probably benign
R4516:Cdh11 UTSW 8 102673962 missense possibly damaging 0.59
R4900:Cdh11 UTSW 8 102647458 splice site probably null
R5441:Cdh11 UTSW 8 102647546 missense probably benign 0.11
R5699:Cdh11 UTSW 8 102634543 missense probably damaging 0.96
R6170:Cdh11 UTSW 8 102634810 missense probably benign 0.00
R6846:Cdh11 UTSW 8 102664644 missense probably damaging 0.97
R7018:Cdh11 UTSW 8 102634321 missense possibly damaging 0.82
R7095:Cdh11 UTSW 8 102658267 missense probably damaging 1.00
R7497:Cdh11 UTSW 8 102673824 missense probably benign 0.00
R7632:Cdh11 UTSW 8 102673883 missense probably damaging 0.99
R7715:Cdh11 UTSW 8 102664714 missense possibly damaging 0.66
R8321:Cdh11 UTSW 8 102634784 missense probably damaging 0.99
R8529:Cdh11 UTSW 8 102664755 missense probably benign 0.01
R8530:Cdh11 UTSW 8 102664755 missense probably benign 0.01
R8682:Cdh11 UTSW 8 102650716 missense probably benign 0.24
R9105:Cdh11 UTSW 8 102634336 missense probably damaging 0.99
R9404:Cdh11 UTSW 8 102679622 missense probably damaging 1.00
R9660:Cdh11 UTSW 8 102658247 missense possibly damaging 0.70
R9684:Cdh11 UTSW 8 102664695 missense probably benign 0.04
R9802:Cdh11 UTSW 8 102664644 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACATTAGAAGCATTCTCAGTGTGG -3'
(R):5'- ATGCTATACCACAGCCAGGC -3'

Sequencing Primer
(F):5'- TTTGGTCCATGAATGAGGAGGAG -3'
(R):5'- TATACCACAGCCAGGCGTTTG -3'
Posted On 2022-10-06