Incidental Mutation 'R9721:Ddx19a'
ID 730800
Institutional Source Beutler Lab
Gene Symbol Ddx19a
Ensembl Gene ENSMUSG00000015023
Gene Name DEAD box helicase 19a
Synonyms Eif4a-rs1, DBP5, DEAD (Asp-Glu-Ala-Asp) box polypeptide 19a, Ddx19
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.957) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 111701628-111724432 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111705107 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 338 (F338S)
Ref Sequence ENSEMBL: ENSMUSP00000047898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040416]
AlphaFold Q61655
Predicted Effect probably damaging
Transcript: ENSMUST00000040416
AA Change: F338S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047898
Gene: ENSMUSG00000015023
AA Change: F338S

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
DEXDc 110 309 8.58e-44 SMART
HELICc 346 433 2.59e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,212,932 (GRCm39) Y120N probably benign Het
AAdacl4fm3 A T 4: 144,429,942 (GRCm39) V349D possibly damaging Het
Alox8 T A 11: 69,087,911 (GRCm39) H131L probably benign Het
Atp13a1 A G 8: 70,252,087 (GRCm39) E588G probably damaging Het
AU040320 G A 4: 126,733,441 (GRCm39) V654M probably damaging Het
Bicra A G 7: 15,713,101 (GRCm39) L982P probably damaging Het
Cdh11 A T 8: 103,406,257 (GRCm39) V72E probably damaging Het
Cfap65 T C 1: 74,958,501 (GRCm39) T869A probably benign Het
Cplane1 A G 15: 8,254,893 (GRCm39) T27A unknown Het
Dhrs7c T A 11: 67,705,904 (GRCm39) V219E probably damaging Het
Dhx33 A G 11: 70,892,424 (GRCm39) V115A probably damaging Het
Dst A G 1: 34,231,866 (GRCm39) D3153G probably benign Het
Ecpas A T 4: 58,850,938 (GRCm39) S412T probably benign Het
Eif5b T C 1: 38,076,740 (GRCm39) probably null Het
Ep300 A G 15: 81,492,516 (GRCm39) N284S unknown Het
Fam83a A G 15: 57,849,513 (GRCm39) N19S probably benign Het
Fgd5 A T 6: 91,965,278 (GRCm39) T504S probably benign Het
Flt4 G A 11: 49,535,260 (GRCm39) probably null Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Gls A G 1: 52,251,427 (GRCm39) V310A probably damaging Het
Gm5414 A T 15: 101,536,582 (GRCm39) C14* probably null Het
Gm9887 C G 12: 69,418,629 (GRCm39) A202P unknown Het
Ifi214 T C 1: 173,355,479 (GRCm39) T110A possibly damaging Het
Il4i1 A G 7: 44,489,113 (GRCm39) R293G probably benign Het
Itpr1 A T 6: 108,383,063 (GRCm39) T1464S probably damaging Het
Kif18a T C 2: 109,123,400 (GRCm39) S225P probably damaging Het
Kif21a A T 15: 90,855,330 (GRCm39) I678N probably damaging Het
Klf11 T A 12: 24,710,240 (GRCm39) D429E probably damaging Het
Kntc1 A G 5: 123,939,948 (GRCm39) T1581A probably benign Het
Lama2 T C 10: 27,343,338 (GRCm39) N45D possibly damaging Het
Lrrk1 T C 7: 65,924,623 (GRCm39) I1319V probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Malrd1 C T 2: 15,701,638 (GRCm39) T751I unknown Het
Matcap1 A T 8: 106,009,820 (GRCm39) D376E probably benign Het
Mgat5b T C 11: 116,857,595 (GRCm39) L363P probably damaging Het
Mphosph9 A T 5: 124,436,738 (GRCm39) S535R possibly damaging Het
Nckap5 C T 1: 125,955,017 (GRCm39) D512N probably damaging Het
Ngef T A 1: 87,406,857 (GRCm39) D637V probably damaging Het
Nup93 T C 8: 95,030,313 (GRCm39) Y391H probably damaging Het
Or10j7 C A 1: 173,011,915 (GRCm39) V29F probably benign Het
Or4c110 T C 2: 88,832,060 (GRCm39) T191A Het
Or5b3 A T 19: 13,388,334 (GRCm39) T134S probably benign Het
Pcdhb4 C A 18: 37,442,905 (GRCm39) D738E possibly damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Phactr3 G A 2: 177,898,043 (GRCm39) E86K probably damaging Het
Psd C T 19: 46,311,628 (GRCm39) D351N probably benign Het
Pzp A G 6: 128,472,154 (GRCm39) probably null Het
Rerg T A 6: 137,033,415 (GRCm39) K106* probably null Het
Samd9l T C 6: 3,375,854 (GRCm39) E469G possibly damaging Het
Smok2b C A 17: 13,453,865 (GRCm39) Y8* probably null Het
Spata31e3 T C 13: 50,400,688 (GRCm39) Y546C possibly damaging Het
Spn A G 7: 126,735,437 (GRCm39) S357P probably benign Het
Tek T G 4: 94,692,539 (GRCm39) W216G possibly damaging Het
Trpm3 A T 19: 22,866,762 (GRCm39) H531L probably benign Het
Trpm6 A G 19: 18,807,336 (GRCm39) M1027V probably benign Het
Tsc2 G A 17: 24,818,616 (GRCm39) R1408* probably null Het
Tut4 T A 4: 108,412,778 (GRCm39) M1493K probably benign Het
Unc13b A G 4: 43,101,869 (GRCm39) N155D probably benign Het
Vmn1r52 G A 6: 90,156,008 (GRCm39) C104Y probably damaging Het
Xylt1 A T 7: 117,148,255 (GRCm39) E273V probably damaging Het
Zc3h4 C A 7: 16,168,770 (GRCm39) Q1035K unknown Het
Zfp14 A T 7: 29,738,609 (GRCm39) S125R probably benign Het
Other mutations in Ddx19a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ddx19a APN 8 111,703,102 (GRCm39) missense probably benign
IGL01395:Ddx19a APN 8 111,717,164 (GRCm39) splice site probably benign
IGL01676:Ddx19a APN 8 111,707,621 (GRCm39) critical splice donor site probably null
IGL02243:Ddx19a APN 8 111,703,088 (GRCm39) missense probably benign 0.06
IGL02677:Ddx19a APN 8 111,716,241 (GRCm39) missense probably benign 0.24
IGL02870:Ddx19a APN 8 111,710,258 (GRCm39) missense probably damaging 1.00
R0416:Ddx19a UTSW 8 111,705,689 (GRCm39) missense probably damaging 0.96
R1574:Ddx19a UTSW 8 111,719,743 (GRCm39) splice site probably benign
R1664:Ddx19a UTSW 8 111,716,130 (GRCm39) missense probably damaging 0.99
R4470:Ddx19a UTSW 8 111,703,111 (GRCm39) missense probably benign 0.00
R4552:Ddx19a UTSW 8 111,705,198 (GRCm39) nonsense probably null
R4668:Ddx19a UTSW 8 111,705,716 (GRCm39) missense probably damaging 1.00
R4847:Ddx19a UTSW 8 111,703,677 (GRCm39) missense probably damaging 1.00
R5390:Ddx19a UTSW 8 111,707,263 (GRCm39) nonsense probably null
R5815:Ddx19a UTSW 8 111,705,781 (GRCm39) nonsense probably null
R6842:Ddx19a UTSW 8 111,705,257 (GRCm39) missense possibly damaging 0.69
R7045:Ddx19a UTSW 8 111,719,706 (GRCm39) missense probably benign
R7647:Ddx19a UTSW 8 111,703,259 (GRCm39) splice site probably null
R8186:Ddx19a UTSW 8 111,710,274 (GRCm39) missense probably benign 0.01
R8716:Ddx19a UTSW 8 111,710,243 (GRCm39) missense probably damaging 0.98
R8986:Ddx19a UTSW 8 111,705,188 (GRCm39) missense probably benign 0.01
R9051:Ddx19a UTSW 8 111,710,228 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ATAGACACCCATCTAGGAATGCTG -3'
(R):5'- CAGATGCTGCTTTTCTCGGC -3'

Sequencing Primer
(F):5'- CCCATCTAGGAATGCTGTGTTAAAC -3'
(R):5'- CCACCTTTGAAGACTCGGTGTG -3'
Posted On 2022-10-06