Incidental Mutation 'R9721:Alox8'
ID 730804
Institutional Source Beutler Lab
Gene Symbol Alox8
Ensembl Gene ENSMUSG00000020891
Gene Name arachidonate 8-lipoxygenase
Synonyms 8S-LOX, 8S-lipoxygenase, 8-LOX, Alox15b
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.114) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 69074758-69088669 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 69087911 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 131 (H131L)
Ref Sequence ENSEMBL: ENSMUSP00000021262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021262] [ENSMUST00000094078]
AlphaFold O35936
Predicted Effect probably benign
Transcript: ENSMUST00000021262
AA Change: H131L

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021262
Gene: ENSMUSG00000020891
AA Change: H131L

DomainStartEndE-ValueType
LH2 2 122 1.07e-36 SMART
Pfam:Lipoxygenase 163 662 5.5e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094078
AA Change: H131L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000091621
Gene: ENSMUSG00000020891
AA Change: H131L

DomainStartEndE-ValueType
LH2 2 122 1.07e-36 SMART
Pfam:Lipoxygenase 205 405 6.9e-44 PFAM
Pfam:Lipoxygenase 402 640 1.9e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the lipoxygenase (LOX) gene family whose members encode enzymes that catalyze the addition of molecular oxygen to polyunsaturated fatty acids (PUFAs) to yield fatty acid hydroperoxides. The encoded enzyme preferentially metabolizes arachidonic acid to yield 8-hydroxyeicosatetraenoic acid (8-HETE), while metabolizing linoleic acid less efficiently. The gene may also function as a tumor suppressor. This gene is located in a cluster of related genes that spans approximately 75 kilobases on chromosome 11. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,212,932 (GRCm39) Y120N probably benign Het
AAdacl4fm3 A T 4: 144,429,942 (GRCm39) V349D possibly damaging Het
Atp13a1 A G 8: 70,252,087 (GRCm39) E588G probably damaging Het
AU040320 G A 4: 126,733,441 (GRCm39) V654M probably damaging Het
Bicra A G 7: 15,713,101 (GRCm39) L982P probably damaging Het
Cdh11 A T 8: 103,406,257 (GRCm39) V72E probably damaging Het
Cfap65 T C 1: 74,958,501 (GRCm39) T869A probably benign Het
Cplane1 A G 15: 8,254,893 (GRCm39) T27A unknown Het
Ddx19a A G 8: 111,705,107 (GRCm39) F338S probably damaging Het
Dhrs7c T A 11: 67,705,904 (GRCm39) V219E probably damaging Het
Dhx33 A G 11: 70,892,424 (GRCm39) V115A probably damaging Het
Dst A G 1: 34,231,866 (GRCm39) D3153G probably benign Het
Ecpas A T 4: 58,850,938 (GRCm39) S412T probably benign Het
Eif5b T C 1: 38,076,740 (GRCm39) probably null Het
Ep300 A G 15: 81,492,516 (GRCm39) N284S unknown Het
Fam83a A G 15: 57,849,513 (GRCm39) N19S probably benign Het
Fgd5 A T 6: 91,965,278 (GRCm39) T504S probably benign Het
Flt4 G A 11: 49,535,260 (GRCm39) probably null Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Gls A G 1: 52,251,427 (GRCm39) V310A probably damaging Het
Gm5414 A T 15: 101,536,582 (GRCm39) C14* probably null Het
Gm9887 C G 12: 69,418,629 (GRCm39) A202P unknown Het
Ifi214 T C 1: 173,355,479 (GRCm39) T110A possibly damaging Het
Il4i1 A G 7: 44,489,113 (GRCm39) R293G probably benign Het
Itpr1 A T 6: 108,383,063 (GRCm39) T1464S probably damaging Het
Kif18a T C 2: 109,123,400 (GRCm39) S225P probably damaging Het
Kif21a A T 15: 90,855,330 (GRCm39) I678N probably damaging Het
Klf11 T A 12: 24,710,240 (GRCm39) D429E probably damaging Het
Kntc1 A G 5: 123,939,948 (GRCm39) T1581A probably benign Het
Lama2 T C 10: 27,343,338 (GRCm39) N45D possibly damaging Het
Lrrk1 T C 7: 65,924,623 (GRCm39) I1319V probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Malrd1 C T 2: 15,701,638 (GRCm39) T751I unknown Het
Matcap1 A T 8: 106,009,820 (GRCm39) D376E probably benign Het
Mgat5b T C 11: 116,857,595 (GRCm39) L363P probably damaging Het
Mphosph9 A T 5: 124,436,738 (GRCm39) S535R possibly damaging Het
Nckap5 C T 1: 125,955,017 (GRCm39) D512N probably damaging Het
Ngef T A 1: 87,406,857 (GRCm39) D637V probably damaging Het
Nup93 T C 8: 95,030,313 (GRCm39) Y391H probably damaging Het
Or10j7 C A 1: 173,011,915 (GRCm39) V29F probably benign Het
Or4c110 T C 2: 88,832,060 (GRCm39) T191A Het
Or5b3 A T 19: 13,388,334 (GRCm39) T134S probably benign Het
Pcdhb4 C A 18: 37,442,905 (GRCm39) D738E possibly damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Phactr3 G A 2: 177,898,043 (GRCm39) E86K probably damaging Het
Psd C T 19: 46,311,628 (GRCm39) D351N probably benign Het
Pzp A G 6: 128,472,154 (GRCm39) probably null Het
Rerg T A 6: 137,033,415 (GRCm39) K106* probably null Het
Samd9l T C 6: 3,375,854 (GRCm39) E469G possibly damaging Het
Smok2b C A 17: 13,453,865 (GRCm39) Y8* probably null Het
Spata31e3 T C 13: 50,400,688 (GRCm39) Y546C possibly damaging Het
Spn A G 7: 126,735,437 (GRCm39) S357P probably benign Het
Tek T G 4: 94,692,539 (GRCm39) W216G possibly damaging Het
Trpm3 A T 19: 22,866,762 (GRCm39) H531L probably benign Het
Trpm6 A G 19: 18,807,336 (GRCm39) M1027V probably benign Het
Tsc2 G A 17: 24,818,616 (GRCm39) R1408* probably null Het
Tut4 T A 4: 108,412,778 (GRCm39) M1493K probably benign Het
Unc13b A G 4: 43,101,869 (GRCm39) N155D probably benign Het
Vmn1r52 G A 6: 90,156,008 (GRCm39) C104Y probably damaging Het
Xylt1 A T 7: 117,148,255 (GRCm39) E273V probably damaging Het
Zc3h4 C A 7: 16,168,770 (GRCm39) Q1035K unknown Het
Zfp14 A T 7: 29,738,609 (GRCm39) S125R probably benign Het
Other mutations in Alox8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Alox8 APN 11 69,079,516 (GRCm39) missense probably benign
IGL01878:Alox8 APN 11 69,087,864 (GRCm39) missense probably benign 0.00
IGL02342:Alox8 APN 11 69,077,053 (GRCm39) missense probably damaging 1.00
IGL02694:Alox8 APN 11 69,077,455 (GRCm39) missense probably damaging 0.99
IGL03246:Alox8 APN 11 69,076,841 (GRCm39) missense probably damaging 1.00
IGL03373:Alox8 APN 11 69,077,443 (GRCm39) missense probably benign 0.00
R0567:Alox8 UTSW 11 69,082,348 (GRCm39) critical splice donor site probably null
R1575:Alox8 UTSW 11 69,076,067 (GRCm39) missense possibly damaging 0.94
R1688:Alox8 UTSW 11 69,080,732 (GRCm39) missense probably benign 0.01
R2021:Alox8 UTSW 11 69,077,114 (GRCm39) missense probably damaging 0.98
R2041:Alox8 UTSW 11 69,088,517 (GRCm39) missense possibly damaging 0.67
R2175:Alox8 UTSW 11 69,078,592 (GRCm39) missense possibly damaging 0.85
R2237:Alox8 UTSW 11 69,076,597 (GRCm39) missense probably benign 0.00
R3821:Alox8 UTSW 11 69,077,308 (GRCm39) missense probably damaging 0.98
R4870:Alox8 UTSW 11 69,077,394 (GRCm39) missense probably damaging 1.00
R6836:Alox8 UTSW 11 69,080,715 (GRCm39) missense possibly damaging 0.82
R6836:Alox8 UTSW 11 69,077,331 (GRCm39) missense probably damaging 1.00
R7003:Alox8 UTSW 11 69,082,416 (GRCm39) missense possibly damaging 0.70
R7158:Alox8 UTSW 11 69,076,696 (GRCm39) missense probably benign 0.00
R7316:Alox8 UTSW 11 69,077,064 (GRCm39) missense probably benign 0.01
R7513:Alox8 UTSW 11 69,078,670 (GRCm39) missense probably benign 0.34
R9515:Alox8 UTSW 11 69,075,950 (GRCm39) missense probably damaging 1.00
X0065:Alox8 UTSW 11 69,076,079 (GRCm39) missense probably damaging 1.00
Z1177:Alox8 UTSW 11 69,076,047 (GRCm39) missense probably damaging 1.00
Z1186:Alox8 UTSW 11 69,088,322 (GRCm39) missense probably benign
Z1186:Alox8 UTSW 11 69,076,873 (GRCm39) missense probably benign 0.00
Z1187:Alox8 UTSW 11 69,088,322 (GRCm39) missense probably benign
Z1187:Alox8 UTSW 11 69,076,873 (GRCm39) missense probably benign 0.00
Z1188:Alox8 UTSW 11 69,088,322 (GRCm39) missense probably benign
Z1188:Alox8 UTSW 11 69,076,873 (GRCm39) missense probably benign 0.00
Z1189:Alox8 UTSW 11 69,088,322 (GRCm39) missense probably benign
Z1189:Alox8 UTSW 11 69,076,873 (GRCm39) missense probably benign 0.00
Z1190:Alox8 UTSW 11 69,088,322 (GRCm39) missense probably benign
Z1190:Alox8 UTSW 11 69,076,873 (GRCm39) missense probably benign 0.00
Z1191:Alox8 UTSW 11 69,088,322 (GRCm39) missense probably benign
Z1191:Alox8 UTSW 11 69,076,873 (GRCm39) missense probably benign 0.00
Z1192:Alox8 UTSW 11 69,088,322 (GRCm39) missense probably benign
Z1192:Alox8 UTSW 11 69,076,873 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAGCCACAGGACAGGGTTG -3'
(R):5'- CTAAGCTTGGGGAGTGGAAACC -3'

Sequencing Primer
(F):5'- CTTGGAAAGAAGCCAGTCTCTCTG -3'
(R):5'- TGGAAACCAGGAAAGGGC -3'
Posted On 2022-10-06