Incidental Mutation 'R9721:Dhx33'
ID 730805
Institutional Source Beutler Lab
Gene Symbol Dhx33
Ensembl Gene ENSMUSG00000040620
Gene Name DEAH-box helicase 33
Synonyms 3110057P17Rik, DEAH (Asp-Glu-Ala-His) box polypeptide 33, 9430096J02Rik, Ddx33
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 70874917-70895258 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70892424 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 115 (V115A)
Ref Sequence ENSEMBL: ENSMUSP00000104167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108527] [ENSMUST00000124464]
AlphaFold Q80VY9
Predicted Effect probably benign
Transcript: ENSMUST00000049048
SMART Domains Protein: ENSMUSP00000038018
Gene: ENSMUSG00000040620

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
Blast:DEXDc 41 76 3e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108527
AA Change: V115A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104167
Gene: ENSMUSG00000040620
AA Change: V115A

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
DEXDc 53 252 1.96e-29 SMART
HELICc 300 401 3.45e-16 SMART
HA2 461 554 3.29e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124464
SMART Domains Protein: ENSMUSP00000136051
Gene: ENSMUSG00000040620

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
HA2 237 330 3.29e-29 SMART
Pfam:OB_NTP_bind 364 464 7.7e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. The DEAD box proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,212,932 (GRCm39) Y120N probably benign Het
AAdacl4fm3 A T 4: 144,429,942 (GRCm39) V349D possibly damaging Het
Alox8 T A 11: 69,087,911 (GRCm39) H131L probably benign Het
Atp13a1 A G 8: 70,252,087 (GRCm39) E588G probably damaging Het
AU040320 G A 4: 126,733,441 (GRCm39) V654M probably damaging Het
Bicra A G 7: 15,713,101 (GRCm39) L982P probably damaging Het
Cdh11 A T 8: 103,406,257 (GRCm39) V72E probably damaging Het
Cfap65 T C 1: 74,958,501 (GRCm39) T869A probably benign Het
Cplane1 A G 15: 8,254,893 (GRCm39) T27A unknown Het
Ddx19a A G 8: 111,705,107 (GRCm39) F338S probably damaging Het
Dhrs7c T A 11: 67,705,904 (GRCm39) V219E probably damaging Het
Dst A G 1: 34,231,866 (GRCm39) D3153G probably benign Het
Ecpas A T 4: 58,850,938 (GRCm39) S412T probably benign Het
Eif5b T C 1: 38,076,740 (GRCm39) probably null Het
Ep300 A G 15: 81,492,516 (GRCm39) N284S unknown Het
Fam83a A G 15: 57,849,513 (GRCm39) N19S probably benign Het
Fgd5 A T 6: 91,965,278 (GRCm39) T504S probably benign Het
Flt4 G A 11: 49,535,260 (GRCm39) probably null Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Gls A G 1: 52,251,427 (GRCm39) V310A probably damaging Het
Gm5414 A T 15: 101,536,582 (GRCm39) C14* probably null Het
Gm9887 C G 12: 69,418,629 (GRCm39) A202P unknown Het
Ifi214 T C 1: 173,355,479 (GRCm39) T110A possibly damaging Het
Il4i1 A G 7: 44,489,113 (GRCm39) R293G probably benign Het
Itpr1 A T 6: 108,383,063 (GRCm39) T1464S probably damaging Het
Kif18a T C 2: 109,123,400 (GRCm39) S225P probably damaging Het
Kif21a A T 15: 90,855,330 (GRCm39) I678N probably damaging Het
Klf11 T A 12: 24,710,240 (GRCm39) D429E probably damaging Het
Kntc1 A G 5: 123,939,948 (GRCm39) T1581A probably benign Het
Lama2 T C 10: 27,343,338 (GRCm39) N45D possibly damaging Het
Lrrk1 T C 7: 65,924,623 (GRCm39) I1319V probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Malrd1 C T 2: 15,701,638 (GRCm39) T751I unknown Het
Matcap1 A T 8: 106,009,820 (GRCm39) D376E probably benign Het
Mgat5b T C 11: 116,857,595 (GRCm39) L363P probably damaging Het
Mphosph9 A T 5: 124,436,738 (GRCm39) S535R possibly damaging Het
Nckap5 C T 1: 125,955,017 (GRCm39) D512N probably damaging Het
Ngef T A 1: 87,406,857 (GRCm39) D637V probably damaging Het
Nup93 T C 8: 95,030,313 (GRCm39) Y391H probably damaging Het
Or10j7 C A 1: 173,011,915 (GRCm39) V29F probably benign Het
Or4c110 T C 2: 88,832,060 (GRCm39) T191A Het
Or5b3 A T 19: 13,388,334 (GRCm39) T134S probably benign Het
Pcdhb4 C A 18: 37,442,905 (GRCm39) D738E possibly damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Phactr3 G A 2: 177,898,043 (GRCm39) E86K probably damaging Het
Psd C T 19: 46,311,628 (GRCm39) D351N probably benign Het
Pzp A G 6: 128,472,154 (GRCm39) probably null Het
Rerg T A 6: 137,033,415 (GRCm39) K106* probably null Het
Samd9l T C 6: 3,375,854 (GRCm39) E469G possibly damaging Het
Smok2b C A 17: 13,453,865 (GRCm39) Y8* probably null Het
Spata31e3 T C 13: 50,400,688 (GRCm39) Y546C possibly damaging Het
Spn A G 7: 126,735,437 (GRCm39) S357P probably benign Het
Tek T G 4: 94,692,539 (GRCm39) W216G possibly damaging Het
Trpm3 A T 19: 22,866,762 (GRCm39) H531L probably benign Het
Trpm6 A G 19: 18,807,336 (GRCm39) M1027V probably benign Het
Tsc2 G A 17: 24,818,616 (GRCm39) R1408* probably null Het
Tut4 T A 4: 108,412,778 (GRCm39) M1493K probably benign Het
Unc13b A G 4: 43,101,869 (GRCm39) N155D probably benign Het
Vmn1r52 G A 6: 90,156,008 (GRCm39) C104Y probably damaging Het
Xylt1 A T 7: 117,148,255 (GRCm39) E273V probably damaging Het
Zc3h4 C A 7: 16,168,770 (GRCm39) Q1035K unknown Het
Zfp14 A T 7: 29,738,609 (GRCm39) S125R probably benign Het
Other mutations in Dhx33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Dhx33 APN 11 70,892,446 (GRCm39) missense probably benign
IGL01357:Dhx33 APN 11 70,884,687 (GRCm39) nonsense probably null
IGL01358:Dhx33 APN 11 70,884,687 (GRCm39) nonsense probably null
IGL01359:Dhx33 APN 11 70,884,687 (GRCm39) nonsense probably null
IGL01360:Dhx33 APN 11 70,884,687 (GRCm39) nonsense probably null
IGL01558:Dhx33 APN 11 70,890,579 (GRCm39) missense probably benign 0.01
IGL02232:Dhx33 APN 11 70,878,030 (GRCm39) missense probably damaging 1.00
IGL02543:Dhx33 APN 11 70,878,066 (GRCm39) missense probably damaging 1.00
R0013:Dhx33 UTSW 11 70,884,461 (GRCm39) missense probably damaging 0.99
R0013:Dhx33 UTSW 11 70,884,461 (GRCm39) missense probably damaging 0.99
R1544:Dhx33 UTSW 11 70,890,354 (GRCm39) missense probably damaging 1.00
R1782:Dhx33 UTSW 11 70,892,466 (GRCm39) missense probably damaging 1.00
R1909:Dhx33 UTSW 11 70,879,933 (GRCm39) missense probably benign 0.02
R2074:Dhx33 UTSW 11 70,890,669 (GRCm39) missense probably damaging 1.00
R3729:Dhx33 UTSW 11 70,879,978 (GRCm39) missense probably benign 0.00
R3731:Dhx33 UTSW 11 70,879,978 (GRCm39) missense probably benign 0.00
R5902:Dhx33 UTSW 11 70,879,957 (GRCm39) missense probably damaging 1.00
R7129:Dhx33 UTSW 11 70,884,689 (GRCm39) missense probably damaging 1.00
R7605:Dhx33 UTSW 11 70,890,299 (GRCm39) missense probably damaging 1.00
R9135:Dhx33 UTSW 11 70,877,992 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAGAGAAAGAACTTGTTCGGAA -3'
(R):5'- GTGACTGTTCGCCAGCCA -3'

Sequencing Primer
(F):5'- CTTGTTCGGAAAAATAAAAGGCTG -3'
(R):5'- CTGAGGCTTAGCAACTCAGTG -3'
Posted On 2022-10-06