Mutagenetix > Incidental Mutation

Incidental Mutation 'R9721:Dhx33'

730805

Institutional Source

Beutler Lab

Gene Symbol

Dhx33

Ensembl Gene

ENSMUSG00000040620

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 33

Synonyms

9430096J02Rik, 3110057P17Rik, Ddx33

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9721 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70984091-71004437 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 71001598 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 115 (V115A)

Ref Sequence

ENSEMBL: ENSMUSP00000104167 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108527] [ENSMUST00000124464]

AlphaFold

Q80VY9

Predicted Effect

probably benign
Transcript: ENSMUST00000049048

SMART Domains

Protein: ENSMUSP00000038018
Gene: ENSMUSG00000040620

Domain	Start	End	E-Value	Type
low complexity region	18	27	N/A	INTRINSIC
Blast:DEXDc	41	76	3e-16	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000108527
AA Change: V115A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000104167
Gene: ENSMUSG00000040620
AA Change: V115A

Domain	Start	End	E-Value	Type
low complexity region	30	39	N/A	INTRINSIC
DEXDc	53	252	1.96e-29	SMART
HELICc	300	401	3.45e-16	SMART
HA2	461	554	3.29e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124464

SMART Domains

Protein: ENSMUSP00000136051
Gene: ENSMUSG00000040620

Domain	Start	End	E-Value	Type
low complexity region	30	39	N/A	INTRINSIC
low complexity region	134	145	N/A	INTRINSIC
HA2	237	330	3.29e-29	SMART
Pfam:OB_NTP_bind	364	464	7.7e-27	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. The DEAD box proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,419,283	Y120N	probably benign	Het
2410089E03Rik	A	G	15: 8,225,409	T27A	unknown	Het
4931428F04Rik	A	T	8: 105,283,188	D376E	probably benign	Het
AI314180	A	T	4: 58,850,938	S412T	probably benign	Het
Alox8	T	A	11: 69,197,085	H131L	probably benign	Het
Atp13a1	A	G	8: 69,799,437	E588G	probably damaging	Het
AU040320	G	A	4: 126,839,648	V654M	probably damaging	Het
Bicra	A	G	7: 15,979,176	L982P	probably damaging	Het
Cdh11	A	T	8: 102,679,625	V72E	probably damaging	Het
Cfap65	T	C	1: 74,919,342	T869A	probably benign	Het
Ddx19a	A	G	8: 110,978,475	F338S	probably damaging	Het
Dhrs7c	T	A	11: 67,815,078	V219E	probably damaging	Het
Dst	A	G	1: 34,192,785	D3153G	probably benign	Het
Eif5b	T	C	1: 38,037,659		probably null	Het
Ep300	A	G	15: 81,608,315	N284S	unknown	Het
Fam83a	A	G	15: 57,986,117	N19S	probably benign	Het
Fgd5	A	T	6: 91,988,297	T504S	probably benign	Het
Flt4	G	A	11: 49,644,433		probably null	Het
Ggta1	G	T	2: 35,413,406	D91E	probably benign	Het
Gls	A	G	1: 52,212,268	V310A	probably damaging	Het
Gm13178	A	T	4: 144,703,372	V349D	possibly damaging	Het
Gm5414	A	T	15: 101,628,147	C14*	probably null	Het
Gm906	T	C	13: 50,246,652	Y546C	possibly damaging	Het
Gm9887	C	G	12: 69,371,855	A202P	unknown	Het
Ifi214	T	C	1: 173,527,913	T110A	possibly damaging	Het
Il4i1	A	G	7: 44,839,689	R293G	probably benign	Het
Itpr1	A	T	6: 108,406,102	T1464S	probably damaging	Het
Kif18a	T	C	2: 109,293,055	S225P	probably damaging	Het
Kif21a	A	T	15: 90,971,127	I678N	probably damaging	Het
Klf11	T	A	12: 24,660,241	D429E	probably damaging	Het
Kntc1	A	G	5: 123,801,885	T1581A	probably benign	Het
Lama2	T	C	10: 27,467,342	N45D	possibly damaging	Het
Lrrk1	T	C	7: 66,274,875	I1319V	probably damaging	Het
Ltbr	G	A	6: 125,307,385	R365W	probably damaging	Het
Malrd1	C	T	2: 15,696,827	T751I	unknown	Het
Mgat5b	T	C	11: 116,966,769	L363P	probably damaging	Het
Mphosph9	A	T	5: 124,298,675	S535R	possibly damaging	Het
Nckap5	C	T	1: 126,027,280	D512N	probably damaging	Het
Ngef	T	A	1: 87,479,135	D637V	probably damaging	Het
Nup93	T	C	8: 94,303,685	Y391H	probably damaging	Het
Olfr1215	T	C	2: 89,001,716	T191A		Het
Olfr1406	C	A	1: 173,184,348	V29F	probably benign	Het
Olfr1469	A	T	19: 13,410,970	T134S	probably benign	Het
Pcdhb4	C	A	18: 37,309,852	D738E	possibly damaging	Het
Pfpl	G	C	19: 12,428,933	E183Q	probably damaging	Het
Phactr3	G	A	2: 178,256,250	E86K	probably damaging	Het
Psd	C	T	19: 46,323,189	D351N	probably benign	Het
Pzp	A	G	6: 128,495,191		probably null	Het
Rerg	T	A	6: 137,056,417	K106*	probably null	Het
Samd9l	T	C	6: 3,375,854	E469G	possibly damaging	Het
Smok2b	C	A	17: 13,234,978	Y8*	probably null	Het
Spn	A	G	7: 127,136,265	S357P	probably benign	Het
Tek	T	G	4: 94,804,302	W216G	possibly damaging	Het
Trpm3	A	T	19: 22,889,398	H531L	probably benign	Het
Trpm6	A	G	19: 18,829,972	M1027V	probably benign	Het
Tsc2	G	A	17: 24,599,642	R1408*	probably null	Het
Unc13b	A	G	4: 43,101,869	N155D	probably benign	Het
Vmn1r52	G	A	6: 90,179,026	C104Y	probably damaging	Het
Xylt1	A	T	7: 117,549,020	E273V	probably damaging	Het
Zc3h4	C	A	7: 16,434,845	Q1035K	unknown	Het
Zcchc11	T	A	4: 108,555,581	M1493K	probably benign	Het
Zfp14	A	T	7: 30,039,184	S125R	probably benign	Het

Other mutations in Dhx33

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Dhx33	APN	11	71001620	missense	probably benign
IGL01357:Dhx33	APN	11	70993861	nonsense	probably null
IGL01358:Dhx33	APN	11	70993861	nonsense	probably null
IGL01359:Dhx33	APN	11	70993861	nonsense	probably null
IGL01360:Dhx33	APN	11	70993861	nonsense	probably null
IGL01558:Dhx33	APN	11	70999753	missense	probably benign	0.01
IGL02232:Dhx33	APN	11	70987204	missense	probably damaging	1.00
IGL02543:Dhx33	APN	11	70987240	missense	probably damaging	1.00
R0013:Dhx33	UTSW	11	70993635	missense	probably damaging	0.99
R0013:Dhx33	UTSW	11	70993635	missense	probably damaging	0.99
R1544:Dhx33	UTSW	11	70999528	missense	probably damaging	1.00
R1782:Dhx33	UTSW	11	71001640	missense	probably damaging	1.00
R1909:Dhx33	UTSW	11	70989107	missense	probably benign	0.02
R2074:Dhx33	UTSW	11	70999843	missense	probably damaging	1.00
R3729:Dhx33	UTSW	11	70989152	missense	probably benign	0.00
R3731:Dhx33	UTSW	11	70989152	missense	probably benign	0.00
R5902:Dhx33	UTSW	11	70989131	missense	probably damaging	1.00
R7129:Dhx33	UTSW	11	70993863	missense	probably damaging	1.00
R7605:Dhx33	UTSW	11	70999473	missense	probably damaging	1.00
R9135:Dhx33	UTSW	11	70987166	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCAGAGAAAGAACTTGTTCGGAA -3'
(R):5'- GTGACTGTTCGCCAGCCA -3'

Sequencing Primer
(F):5'- CTTGTTCGGAAAAATAAAAGGCTG -3'
(R):5'- CTGAGGCTTAGCAACTCAGTG -3'

Posted On

2022-10-06