Incidental Mutation 'R9721:Klf11'
ID 730807
Institutional Source Beutler Lab
Gene Symbol Klf11
Ensembl Gene ENSMUSG00000020653
Gene Name Kruppel-like factor 11
Synonyms Tieg2b, D12Ertd427e, Tieg3, Tieg2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 24651274-24662789 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 24660241 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 429 (D429E)
Ref Sequence ENSEMBL: ENSMUSP00000020982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020982]
AlphaFold Q8K1S5
Predicted Effect probably damaging
Transcript: ENSMUST00000020982
AA Change: D429E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020982
Gene: ENSMUSG00000020653
AA Change: D429E

DomainStartEndE-ValueType
low complexity region 267 275 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
ZnF_C2H2 384 408 5.9e-3 SMART
ZnF_C2H2 414 438 9.22e-5 SMART
ZnF_C2H2 444 466 1.38e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to SP1-like sequences in epsilon- and gamma-globin gene promoters. This binding inhibits cell growth and causes apoptosis. Defects in this gene are a cause of maturity-onset diabetes of the young type 7 (MODY7). Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile, show normal hematopoiesis, growth and development, and display no evidence of increased tumor formation following gamma-irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,419,283 Y120N probably benign Het
2410089E03Rik A G 15: 8,225,409 T27A unknown Het
4931428F04Rik A T 8: 105,283,188 D376E probably benign Het
AI314180 A T 4: 58,850,938 S412T probably benign Het
Alox8 T A 11: 69,197,085 H131L probably benign Het
Atp13a1 A G 8: 69,799,437 E588G probably damaging Het
AU040320 G A 4: 126,839,648 V654M probably damaging Het
Bicra A G 7: 15,979,176 L982P probably damaging Het
Cdh11 A T 8: 102,679,625 V72E probably damaging Het
Cfap65 T C 1: 74,919,342 T869A probably benign Het
Ddx19a A G 8: 110,978,475 F338S probably damaging Het
Dhrs7c T A 11: 67,815,078 V219E probably damaging Het
Dhx33 A G 11: 71,001,598 V115A probably damaging Het
Dst A G 1: 34,192,785 D3153G probably benign Het
Eif5b T C 1: 38,037,659 probably null Het
Ep300 A G 15: 81,608,315 N284S unknown Het
Fam83a A G 15: 57,986,117 N19S probably benign Het
Fgd5 A T 6: 91,988,297 T504S probably benign Het
Flt4 G A 11: 49,644,433 probably null Het
Ggta1 G T 2: 35,413,406 D91E probably benign Het
Gls A G 1: 52,212,268 V310A probably damaging Het
Gm13178 A T 4: 144,703,372 V349D possibly damaging Het
Gm5414 A T 15: 101,628,147 C14* probably null Het
Gm906 T C 13: 50,246,652 Y546C possibly damaging Het
Gm9887 C G 12: 69,371,855 A202P unknown Het
Ifi214 T C 1: 173,527,913 T110A possibly damaging Het
Il4i1 A G 7: 44,839,689 R293G probably benign Het
Itpr1 A T 6: 108,406,102 T1464S probably damaging Het
Kif18a T C 2: 109,293,055 S225P probably damaging Het
Kif21a A T 15: 90,971,127 I678N probably damaging Het
Kntc1 A G 5: 123,801,885 T1581A probably benign Het
Lama2 T C 10: 27,467,342 N45D possibly damaging Het
Lrrk1 T C 7: 66,274,875 I1319V probably damaging Het
Ltbr G A 6: 125,307,385 R365W probably damaging Het
Malrd1 C T 2: 15,696,827 T751I unknown Het
Mgat5b T C 11: 116,966,769 L363P probably damaging Het
Mphosph9 A T 5: 124,298,675 S535R possibly damaging Het
Nckap5 C T 1: 126,027,280 D512N probably damaging Het
Ngef T A 1: 87,479,135 D637V probably damaging Het
Nup93 T C 8: 94,303,685 Y391H probably damaging Het
Olfr1215 T C 2: 89,001,716 T191A Het
Olfr1406 C A 1: 173,184,348 V29F probably benign Het
Olfr1469 A T 19: 13,410,970 T134S probably benign Het
Pcdhb4 C A 18: 37,309,852 D738E possibly damaging Het
Pfpl G C 19: 12,428,933 E183Q probably damaging Het
Phactr3 G A 2: 178,256,250 E86K probably damaging Het
Psd C T 19: 46,323,189 D351N probably benign Het
Pzp A G 6: 128,495,191 probably null Het
Rerg T A 6: 137,056,417 K106* probably null Het
Samd9l T C 6: 3,375,854 E469G possibly damaging Het
Smok2b C A 17: 13,234,978 Y8* probably null Het
Spn A G 7: 127,136,265 S357P probably benign Het
Tek T G 4: 94,804,302 W216G possibly damaging Het
Trpm3 A T 19: 22,889,398 H531L probably benign Het
Trpm6 A G 19: 18,829,972 M1027V probably benign Het
Tsc2 G A 17: 24,599,642 R1408* probably null Het
Unc13b A G 4: 43,101,869 N155D probably benign Het
Vmn1r52 G A 6: 90,179,026 C104Y probably damaging Het
Xylt1 A T 7: 117,549,020 E273V probably damaging Het
Zc3h4 C A 7: 16,434,845 Q1035K unknown Het
Zcchc11 T A 4: 108,555,581 M1493K probably benign Het
Zfp14 A T 7: 30,039,184 S125R probably benign Het
Other mutations in Klf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Klf11 APN 12 24660369 missense probably benign 0.01
IGL02202:Klf11 APN 12 24653632 missense probably benign 0.37
IGL02527:Klf11 APN 12 24655323 missense probably benign 0.31
IGL02964:Klf11 APN 12 24655627 missense probably damaging 1.00
R0254:Klf11 UTSW 12 24653583 missense probably damaging 1.00
R0553:Klf11 UTSW 12 24655090 missense probably benign 0.12
R0739:Klf11 UTSW 12 24660248 missense probably damaging 1.00
R1584:Klf11 UTSW 12 24655305 missense probably damaging 1.00
R1592:Klf11 UTSW 12 24653738 missense probably damaging 1.00
R2356:Klf11 UTSW 12 24653583 missense probably damaging 1.00
R3085:Klf11 UTSW 12 24655491 missense probably benign
R4690:Klf11 UTSW 12 24655072 missense probably damaging 0.97
R5023:Klf11 UTSW 12 24655359 missense probably benign 0.00
R5483:Klf11 UTSW 12 24655411 nonsense probably null
R5528:Klf11 UTSW 12 24654930 missense probably benign 0.00
R6148:Klf11 UTSW 12 24651568 critical splice donor site probably null
R6698:Klf11 UTSW 12 24653619 missense probably damaging 1.00
R6799:Klf11 UTSW 12 24655639 missense possibly damaging 0.59
R7317:Klf11 UTSW 12 24655519 missense possibly damaging 0.59
R7384:Klf11 UTSW 12 24653743 missense probably damaging 0.97
R7440:Klf11 UTSW 12 24655491 missense probably benign
R7473:Klf11 UTSW 12 24655142 splice site probably null
R7477:Klf11 UTSW 12 24653563 missense probably benign 0.01
R7658:Klf11 UTSW 12 24653671 missense probably damaging 1.00
R9378:Klf11 UTSW 12 24655044 missense probably benign 0.01
R9479:Klf11 UTSW 12 24655030 missense probably benign 0.10
R9663:Klf11 UTSW 12 24655732 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGCAGCTGTTAGTCTTCTG -3'
(R):5'- ATGCCACAGAAGGATGCCTC -3'

Sequencing Primer
(F):5'- CTTCTGCTGTCTGATGAGCAG -3'
(R):5'- AAGGGTTCGAGGATGCTCC -3'
Posted On 2022-10-06