Incidental Mutation 'R9721:Ep300'
ID 730812
Institutional Source Beutler Lab
Gene Symbol Ep300
Ensembl Gene ENSMUSG00000055024
Gene Name E1A binding protein p300
Synonyms p300, KAT3B
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 81470329-81536278 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81492516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 284 (N284S)
Ref Sequence ENSEMBL: ENSMUSP00000066789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068387]
AlphaFold B2RWS6
Predicted Effect unknown
Transcript: ENSMUST00000068387
AA Change: N284S
SMART Domains Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024
AA Change: N284S

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
low complexity region 162 178 N/A INTRINSIC
low complexity region 223 242 N/A INTRINSIC
low complexity region 296 309 N/A INTRINSIC
ZnF_TAZ 333 418 2.85e-32 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 492 503 N/A INTRINSIC
Pfam:KIX 567 647 7.2e-44 PFAM
low complexity region 722 735 N/A INTRINSIC
low complexity region 831 848 N/A INTRINSIC
low complexity region 852 882 N/A INTRINSIC
low complexity region 884 920 N/A INTRINSIC
low complexity region 924 943 N/A INTRINSIC
low complexity region 1024 1039 N/A INTRINSIC
BROMO 1047 1157 6.36e-42 SMART
Blast:KAT11 1227 1300 9e-22 BLAST
KAT11 1305 1610 1.19e-140 SMART
ZnF_ZZ 1663 1704 2.67e-15 SMART
ZnF_TAZ 1728 1806 5.53e-30 SMART
low complexity region 1810 1836 N/A INTRINSIC
low complexity region 1847 1881 N/A INTRINSIC
low complexity region 1902 1927 N/A INTRINSIC
low complexity region 1962 1979 N/A INTRINSIC
Pfam:Creb_binding 1993 2099 3.5e-37 PFAM
low complexity region 2146 2158 N/A INTRINSIC
low complexity region 2187 2203 N/A INTRINSIC
low complexity region 2205 2244 N/A INTRINSIC
low complexity region 2254 2265 N/A INTRINSIC
low complexity region 2303 2346 N/A INTRINSIC
low complexity region 2390 2405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185967
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,212,932 (GRCm39) Y120N probably benign Het
AAdacl4fm3 A T 4: 144,429,942 (GRCm39) V349D possibly damaging Het
Alox8 T A 11: 69,087,911 (GRCm39) H131L probably benign Het
Atp13a1 A G 8: 70,252,087 (GRCm39) E588G probably damaging Het
AU040320 G A 4: 126,733,441 (GRCm39) V654M probably damaging Het
Bicra A G 7: 15,713,101 (GRCm39) L982P probably damaging Het
Cdh11 A T 8: 103,406,257 (GRCm39) V72E probably damaging Het
Cfap65 T C 1: 74,958,501 (GRCm39) T869A probably benign Het
Cplane1 A G 15: 8,254,893 (GRCm39) T27A unknown Het
Ddx19a A G 8: 111,705,107 (GRCm39) F338S probably damaging Het
Dhrs7c T A 11: 67,705,904 (GRCm39) V219E probably damaging Het
Dhx33 A G 11: 70,892,424 (GRCm39) V115A probably damaging Het
Dst A G 1: 34,231,866 (GRCm39) D3153G probably benign Het
Ecpas A T 4: 58,850,938 (GRCm39) S412T probably benign Het
Eif5b T C 1: 38,076,740 (GRCm39) probably null Het
Fam83a A G 15: 57,849,513 (GRCm39) N19S probably benign Het
Fgd5 A T 6: 91,965,278 (GRCm39) T504S probably benign Het
Flt4 G A 11: 49,535,260 (GRCm39) probably null Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Gls A G 1: 52,251,427 (GRCm39) V310A probably damaging Het
Gm5414 A T 15: 101,536,582 (GRCm39) C14* probably null Het
Gm9887 C G 12: 69,418,629 (GRCm39) A202P unknown Het
Ifi214 T C 1: 173,355,479 (GRCm39) T110A possibly damaging Het
Il4i1 A G 7: 44,489,113 (GRCm39) R293G probably benign Het
Itpr1 A T 6: 108,383,063 (GRCm39) T1464S probably damaging Het
Kif18a T C 2: 109,123,400 (GRCm39) S225P probably damaging Het
Kif21a A T 15: 90,855,330 (GRCm39) I678N probably damaging Het
Klf11 T A 12: 24,710,240 (GRCm39) D429E probably damaging Het
Kntc1 A G 5: 123,939,948 (GRCm39) T1581A probably benign Het
Lama2 T C 10: 27,343,338 (GRCm39) N45D possibly damaging Het
Lrrk1 T C 7: 65,924,623 (GRCm39) I1319V probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Malrd1 C T 2: 15,701,638 (GRCm39) T751I unknown Het
Matcap1 A T 8: 106,009,820 (GRCm39) D376E probably benign Het
Mgat5b T C 11: 116,857,595 (GRCm39) L363P probably damaging Het
Mphosph9 A T 5: 124,436,738 (GRCm39) S535R possibly damaging Het
Nckap5 C T 1: 125,955,017 (GRCm39) D512N probably damaging Het
Ngef T A 1: 87,406,857 (GRCm39) D637V probably damaging Het
Nup93 T C 8: 95,030,313 (GRCm39) Y391H probably damaging Het
Or10j7 C A 1: 173,011,915 (GRCm39) V29F probably benign Het
Or4c110 T C 2: 88,832,060 (GRCm39) T191A Het
Or5b3 A T 19: 13,388,334 (GRCm39) T134S probably benign Het
Pcdhb4 C A 18: 37,442,905 (GRCm39) D738E possibly damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Phactr3 G A 2: 177,898,043 (GRCm39) E86K probably damaging Het
Psd C T 19: 46,311,628 (GRCm39) D351N probably benign Het
Pzp A G 6: 128,472,154 (GRCm39) probably null Het
Rerg T A 6: 137,033,415 (GRCm39) K106* probably null Het
Samd9l T C 6: 3,375,854 (GRCm39) E469G possibly damaging Het
Smok2b C A 17: 13,453,865 (GRCm39) Y8* probably null Het
Spata31e3 T C 13: 50,400,688 (GRCm39) Y546C possibly damaging Het
Spn A G 7: 126,735,437 (GRCm39) S357P probably benign Het
Tek T G 4: 94,692,539 (GRCm39) W216G possibly damaging Het
Trpm3 A T 19: 22,866,762 (GRCm39) H531L probably benign Het
Trpm6 A G 19: 18,807,336 (GRCm39) M1027V probably benign Het
Tsc2 G A 17: 24,818,616 (GRCm39) R1408* probably null Het
Tut4 T A 4: 108,412,778 (GRCm39) M1493K probably benign Het
Unc13b A G 4: 43,101,869 (GRCm39) N155D probably benign Het
Vmn1r52 G A 6: 90,156,008 (GRCm39) C104Y probably damaging Het
Xylt1 A T 7: 117,148,255 (GRCm39) E273V probably damaging Het
Zc3h4 C A 7: 16,168,770 (GRCm39) Q1035K unknown Het
Zfp14 A T 7: 29,738,609 (GRCm39) S125R probably benign Het
Other mutations in Ep300
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ep300 APN 15 81,525,619 (GRCm39) missense unknown
IGL01128:Ep300 APN 15 81,514,207 (GRCm39) unclassified probably benign
IGL01151:Ep300 APN 15 81,507,673 (GRCm39) intron probably benign
IGL01414:Ep300 APN 15 81,511,467 (GRCm39) unclassified probably benign
IGL01564:Ep300 APN 15 81,516,665 (GRCm39) unclassified probably benign
IGL01875:Ep300 APN 15 81,524,224 (GRCm39) missense unknown
IGL01945:Ep300 APN 15 81,500,310 (GRCm39) unclassified probably benign
IGL02022:Ep300 APN 15 81,495,638 (GRCm39) unclassified probably benign
IGL02115:Ep300 APN 15 81,533,019 (GRCm39) missense unknown
IGL02129:Ep300 APN 15 81,470,837 (GRCm39) missense unknown
IGL02145:Ep300 APN 15 81,485,367 (GRCm39) missense unknown
IGL02149:Ep300 APN 15 81,512,621 (GRCm39) unclassified probably benign
IGL02165:Ep300 APN 15 81,525,592 (GRCm39) missense probably benign 0.39
IGL02226:Ep300 APN 15 81,497,613 (GRCm39) missense unknown
IGL02610:Ep300 APN 15 81,485,723 (GRCm39) missense unknown
IGL02731:Ep300 APN 15 81,532,615 (GRCm39) missense unknown
IGL03239:Ep300 APN 15 81,525,589 (GRCm39) missense unknown
BB001:Ep300 UTSW 15 81,533,703 (GRCm39) missense unknown
BB011:Ep300 UTSW 15 81,533,703 (GRCm39) missense unknown
R0077:Ep300 UTSW 15 81,525,514 (GRCm39) missense unknown
R0145:Ep300 UTSW 15 81,500,328 (GRCm39) critical splice donor site probably null
R0244:Ep300 UTSW 15 81,524,329 (GRCm39) missense unknown
R0390:Ep300 UTSW 15 81,524,317 (GRCm39) missense unknown
R0534:Ep300 UTSW 15 81,485,097 (GRCm39) splice site probably benign
R0671:Ep300 UTSW 15 81,500,335 (GRCm39) unclassified probably benign
R0840:Ep300 UTSW 15 81,529,134 (GRCm39) missense unknown
R1166:Ep300 UTSW 15 81,514,265 (GRCm39) unclassified probably benign
R1737:Ep300 UTSW 15 81,510,548 (GRCm39) missense probably damaging 0.99
R1893:Ep300 UTSW 15 81,515,847 (GRCm39) unclassified probably benign
R2136:Ep300 UTSW 15 81,524,648 (GRCm39) missense unknown
R3427:Ep300 UTSW 15 81,485,480 (GRCm39) missense unknown
R3757:Ep300 UTSW 15 81,532,790 (GRCm39) missense unknown
R3892:Ep300 UTSW 15 81,504,198 (GRCm39) unclassified probably benign
R4554:Ep300 UTSW 15 81,485,631 (GRCm39) missense unknown
R4575:Ep300 UTSW 15 81,495,611 (GRCm39) unclassified probably benign
R4575:Ep300 UTSW 15 81,533,210 (GRCm39) missense unknown
R4577:Ep300 UTSW 15 81,495,611 (GRCm39) unclassified probably benign
R4577:Ep300 UTSW 15 81,533,210 (GRCm39) missense unknown
R4578:Ep300 UTSW 15 81,495,611 (GRCm39) unclassified probably benign
R4578:Ep300 UTSW 15 81,533,210 (GRCm39) missense unknown
R5021:Ep300 UTSW 15 81,524,224 (GRCm39) missense unknown
R5366:Ep300 UTSW 15 81,500,301 (GRCm39) missense probably benign 0.24
R5372:Ep300 UTSW 15 81,521,031 (GRCm39) missense unknown
R5393:Ep300 UTSW 15 81,515,819 (GRCm39) unclassified probably benign
R5410:Ep300 UTSW 15 81,533,055 (GRCm39) missense unknown
R5571:Ep300 UTSW 15 81,527,418 (GRCm39) intron probably benign
R5701:Ep300 UTSW 15 81,485,696 (GRCm39) missense unknown
R5772:Ep300 UTSW 15 81,524,115 (GRCm39) intron probably benign
R5825:Ep300 UTSW 15 81,495,673 (GRCm39) missense probably benign 0.39
R5917:Ep300 UTSW 15 81,512,808 (GRCm39) unclassified probably benign
R5991:Ep300 UTSW 15 81,532,667 (GRCm39) missense unknown
R6019:Ep300 UTSW 15 81,525,583 (GRCm39) missense unknown
R6144:Ep300 UTSW 15 81,485,435 (GRCm39) missense unknown
R6291:Ep300 UTSW 15 81,532,708 (GRCm39) missense unknown
R6292:Ep300 UTSW 15 81,500,935 (GRCm39) unclassified probably benign
R6599:Ep300 UTSW 15 81,470,914 (GRCm39) missense unknown
R6804:Ep300 UTSW 15 81,525,512 (GRCm39) nonsense probably null
R6925:Ep300 UTSW 15 81,534,182 (GRCm39) missense probably benign 0.32
R7327:Ep300 UTSW 15 81,511,515 (GRCm39) missense unknown
R7378:Ep300 UTSW 15 81,534,746 (GRCm39) missense probably damaging 0.97
R7388:Ep300 UTSW 15 81,532,567 (GRCm39) missense unknown
R7419:Ep300 UTSW 15 81,532,715 (GRCm39) missense unknown
R7498:Ep300 UTSW 15 81,524,044 (GRCm39) missense unknown
R7584:Ep300 UTSW 15 81,512,627 (GRCm39) missense unknown
R7605:Ep300 UTSW 15 81,505,353 (GRCm39) missense unknown
R7619:Ep300 UTSW 15 81,492,399 (GRCm39) missense unknown
R7699:Ep300 UTSW 15 81,470,594 (GRCm39) start gained probably benign
R7763:Ep300 UTSW 15 81,470,784 (GRCm39) start gained probably benign
R7775:Ep300 UTSW 15 81,470,887 (GRCm39) missense unknown
R7778:Ep300 UTSW 15 81,470,887 (GRCm39) missense unknown
R7862:Ep300 UTSW 15 81,534,954 (GRCm39) missense probably damaging 1.00
R7924:Ep300 UTSW 15 81,533,703 (GRCm39) missense unknown
R8155:Ep300 UTSW 15 81,505,269 (GRCm39) missense unknown
R8259:Ep300 UTSW 15 81,523,218 (GRCm39) missense unknown
R8276:Ep300 UTSW 15 81,534,229 (GRCm39) missense possibly damaging 0.85
R8331:Ep300 UTSW 15 81,485,411 (GRCm39) missense unknown
R8554:Ep300 UTSW 15 81,523,228 (GRCm39) missense unknown
R9019:Ep300 UTSW 15 81,532,730 (GRCm39) missense unknown
R9128:Ep300 UTSW 15 81,533,946 (GRCm39) missense unknown
R9379:Ep300 UTSW 15 81,532,760 (GRCm39) missense unknown
R9380:Ep300 UTSW 15 81,500,245 (GRCm39) missense unknown
R9484:Ep300 UTSW 15 81,521,026 (GRCm39) missense unknown
R9659:Ep300 UTSW 15 81,505,273 (GRCm39) missense unknown
R9690:Ep300 UTSW 15 81,520,396 (GRCm39) missense unknown
RF020:Ep300 UTSW 15 81,470,772 (GRCm39) start gained probably benign
Z1177:Ep300 UTSW 15 81,514,298 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CATGAAGTATGGTCATGGTGATGTC -3'
(R):5'- GCTCACAAAGTGGCTCAATACG -3'

Sequencing Primer
(F):5'- GTCATGGTGATGTCTTAGTAATACAG -3'
(R):5'- CTGGCAGACTTCAGAATTCCAGG -3'
Posted On 2022-10-06