Incidental Mutation 'R9721:Kif21a'
ID 730813
Institutional Source Beutler Lab
Gene Symbol Kif21a
Ensembl Gene ENSMUSG00000022629
Gene Name kinesin family member 21A
Synonyms N-5 kinesin
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 90817479-90934151 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90855330 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 678 (I678N)
Ref Sequence ENSEMBL: ENSMUSP00000104911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067205] [ENSMUST00000088614] [ENSMUST00000100304] [ENSMUST00000109287] [ENSMUST00000109288] [ENSMUST00000229801]
AlphaFold Q9QXL2
Predicted Effect probably damaging
Transcript: ENSMUST00000067205
AA Change: I678N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066911
Gene: ENSMUSG00000022629
AA Change: I678N

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1251 1271 N/A INTRINSIC
WD40 1290 1327 1.21e-7 SMART
WD40 1330 1368 7.28e-2 SMART
WD40 1394 1432 3.33e-1 SMART
WD40 1435 1477 7e-4 SMART
WD40 1485 1523 2.4e-1 SMART
WD40 1527 1566 1.48e-2 SMART
WD40 1569 1606 2.07e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088614
AA Change: I691N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085985
Gene: ENSMUSG00000022629
AA Change: I691N

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100304
AA Change: I691N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097877
Gene: ENSMUSG00000022629
AA Change: I691N

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109287
AA Change: I678N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104910
Gene: ENSMUSG00000022629
AA Change: I678N

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
WD40 1229 1266 1.21e-7 SMART
WD40 1269 1307 7.28e-2 SMART
WD40 1333 1371 3.33e-1 SMART
WD40 1374 1416 7e-4 SMART
WD40 1424 1462 2.4e-1 SMART
WD40 1466 1505 1.48e-2 SMART
WD40 1508 1545 2.07e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109288
AA Change: I678N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104911
Gene: ENSMUSG00000022629
AA Change: I678N

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
WD40 1235 1272 1.21e-7 SMART
WD40 1275 1313 7.28e-2 SMART
WD40 1339 1377 3.33e-1 SMART
WD40 1380 1422 7e-4 SMART
WD40 1430 1468 2.4e-1 SMART
WD40 1472 1511 1.48e-2 SMART
WD40 1514 1551 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229801
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KIF4 subfamily of kinesin-like motor proteins. The encoded protein is characterized by an N-terminal motor domain a coiled-coil stalk domain and a C-terminal WD-40 repeat domain. This protein may be involved in microtubule dependent transport. Mutations in this gene are the cause of congenital fibrosis of extraocular muscles-1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,212,932 (GRCm39) Y120N probably benign Het
AAdacl4fm3 A T 4: 144,429,942 (GRCm39) V349D possibly damaging Het
Alox8 T A 11: 69,087,911 (GRCm39) H131L probably benign Het
Atp13a1 A G 8: 70,252,087 (GRCm39) E588G probably damaging Het
AU040320 G A 4: 126,733,441 (GRCm39) V654M probably damaging Het
Bicra A G 7: 15,713,101 (GRCm39) L982P probably damaging Het
Cdh11 A T 8: 103,406,257 (GRCm39) V72E probably damaging Het
Cfap65 T C 1: 74,958,501 (GRCm39) T869A probably benign Het
Cplane1 A G 15: 8,254,893 (GRCm39) T27A unknown Het
Ddx19a A G 8: 111,705,107 (GRCm39) F338S probably damaging Het
Dhrs7c T A 11: 67,705,904 (GRCm39) V219E probably damaging Het
Dhx33 A G 11: 70,892,424 (GRCm39) V115A probably damaging Het
Dst A G 1: 34,231,866 (GRCm39) D3153G probably benign Het
Ecpas A T 4: 58,850,938 (GRCm39) S412T probably benign Het
Eif5b T C 1: 38,076,740 (GRCm39) probably null Het
Ep300 A G 15: 81,492,516 (GRCm39) N284S unknown Het
Fam83a A G 15: 57,849,513 (GRCm39) N19S probably benign Het
Fgd5 A T 6: 91,965,278 (GRCm39) T504S probably benign Het
Flt4 G A 11: 49,535,260 (GRCm39) probably null Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Gls A G 1: 52,251,427 (GRCm39) V310A probably damaging Het
Gm5414 A T 15: 101,536,582 (GRCm39) C14* probably null Het
Gm9887 C G 12: 69,418,629 (GRCm39) A202P unknown Het
Ifi214 T C 1: 173,355,479 (GRCm39) T110A possibly damaging Het
Il4i1 A G 7: 44,489,113 (GRCm39) R293G probably benign Het
Itpr1 A T 6: 108,383,063 (GRCm39) T1464S probably damaging Het
Kif18a T C 2: 109,123,400 (GRCm39) S225P probably damaging Het
Klf11 T A 12: 24,710,240 (GRCm39) D429E probably damaging Het
Kntc1 A G 5: 123,939,948 (GRCm39) T1581A probably benign Het
Lama2 T C 10: 27,343,338 (GRCm39) N45D possibly damaging Het
Lrrk1 T C 7: 65,924,623 (GRCm39) I1319V probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Malrd1 C T 2: 15,701,638 (GRCm39) T751I unknown Het
Matcap1 A T 8: 106,009,820 (GRCm39) D376E probably benign Het
Mgat5b T C 11: 116,857,595 (GRCm39) L363P probably damaging Het
Mphosph9 A T 5: 124,436,738 (GRCm39) S535R possibly damaging Het
Nckap5 C T 1: 125,955,017 (GRCm39) D512N probably damaging Het
Ngef T A 1: 87,406,857 (GRCm39) D637V probably damaging Het
Nup93 T C 8: 95,030,313 (GRCm39) Y391H probably damaging Het
Or10j7 C A 1: 173,011,915 (GRCm39) V29F probably benign Het
Or4c110 T C 2: 88,832,060 (GRCm39) T191A Het
Or5b3 A T 19: 13,388,334 (GRCm39) T134S probably benign Het
Pcdhb4 C A 18: 37,442,905 (GRCm39) D738E possibly damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Phactr3 G A 2: 177,898,043 (GRCm39) E86K probably damaging Het
Psd C T 19: 46,311,628 (GRCm39) D351N probably benign Het
Pzp A G 6: 128,472,154 (GRCm39) probably null Het
Rerg T A 6: 137,033,415 (GRCm39) K106* probably null Het
Samd9l T C 6: 3,375,854 (GRCm39) E469G possibly damaging Het
Smok2b C A 17: 13,453,865 (GRCm39) Y8* probably null Het
Spata31e3 T C 13: 50,400,688 (GRCm39) Y546C possibly damaging Het
Spn A G 7: 126,735,437 (GRCm39) S357P probably benign Het
Tek T G 4: 94,692,539 (GRCm39) W216G possibly damaging Het
Trpm3 A T 19: 22,866,762 (GRCm39) H531L probably benign Het
Trpm6 A G 19: 18,807,336 (GRCm39) M1027V probably benign Het
Tsc2 G A 17: 24,818,616 (GRCm39) R1408* probably null Het
Tut4 T A 4: 108,412,778 (GRCm39) M1493K probably benign Het
Unc13b A G 4: 43,101,869 (GRCm39) N155D probably benign Het
Vmn1r52 G A 6: 90,156,008 (GRCm39) C104Y probably damaging Het
Xylt1 A T 7: 117,148,255 (GRCm39) E273V probably damaging Het
Zc3h4 C A 7: 16,168,770 (GRCm39) Q1035K unknown Het
Zfp14 A T 7: 29,738,609 (GRCm39) S125R probably benign Het
Other mutations in Kif21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Kif21a APN 15 90,821,504 (GRCm39) missense probably damaging 1.00
IGL01476:Kif21a APN 15 90,828,067 (GRCm39) missense possibly damaging 0.66
IGL01617:Kif21a APN 15 90,879,840 (GRCm39) splice site probably benign
IGL01736:Kif21a APN 15 90,843,948 (GRCm39) missense possibly damaging 0.59
IGL01923:Kif21a APN 15 90,840,633 (GRCm39) missense probably damaging 0.96
IGL01985:Kif21a APN 15 90,875,970 (GRCm39) missense probably damaging 1.00
IGL02304:Kif21a APN 15 90,849,738 (GRCm39) missense probably damaging 1.00
IGL02589:Kif21a APN 15 90,869,489 (GRCm39) missense probably damaging 1.00
IGL03115:Kif21a APN 15 90,869,598 (GRCm39) missense probably damaging 0.99
IGL03211:Kif21a APN 15 90,882,166 (GRCm39) missense possibly damaging 0.73
IGL03372:Kif21a APN 15 90,840,579 (GRCm39) missense probably benign 0.38
reflex UTSW 15 90,852,561 (GRCm39) missense probably null 1.00
R0052:Kif21a UTSW 15 90,855,060 (GRCm39) missense probably damaging 0.98
R0052:Kif21a UTSW 15 90,855,060 (GRCm39) missense probably damaging 0.98
R0304:Kif21a UTSW 15 90,860,724 (GRCm39) splice site probably null
R0378:Kif21a UTSW 15 90,853,977 (GRCm39) splice site probably null
R0420:Kif21a UTSW 15 90,852,257 (GRCm39) unclassified probably benign
R0536:Kif21a UTSW 15 90,843,886 (GRCm39) splice site probably benign
R0826:Kif21a UTSW 15 90,881,744 (GRCm39) critical splice donor site probably null
R0971:Kif21a UTSW 15 90,824,784 (GRCm39) missense possibly damaging 0.46
R1052:Kif21a UTSW 15 90,819,853 (GRCm39) missense probably benign 0.17
R1168:Kif21a UTSW 15 90,877,956 (GRCm39) missense probably damaging 1.00
R1324:Kif21a UTSW 15 90,832,525 (GRCm39) critical splice donor site probably null
R1471:Kif21a UTSW 15 90,840,622 (GRCm39) missense probably benign 0.04
R1625:Kif21a UTSW 15 90,826,378 (GRCm39) missense probably damaging 1.00
R1636:Kif21a UTSW 15 90,869,008 (GRCm39) splice site probably benign
R1647:Kif21a UTSW 15 90,878,570 (GRCm39) missense probably damaging 1.00
R1648:Kif21a UTSW 15 90,878,570 (GRCm39) missense probably damaging 1.00
R1699:Kif21a UTSW 15 90,843,946 (GRCm39) missense probably damaging 0.99
R1703:Kif21a UTSW 15 90,833,250 (GRCm39) splice site probably null
R1795:Kif21a UTSW 15 90,856,930 (GRCm39) splice site probably null
R1812:Kif21a UTSW 15 90,855,969 (GRCm39) missense possibly damaging 0.63
R1959:Kif21a UTSW 15 90,855,051 (GRCm39) missense probably damaging 0.99
R1960:Kif21a UTSW 15 90,855,051 (GRCm39) missense probably damaging 0.99
R1961:Kif21a UTSW 15 90,855,051 (GRCm39) missense probably damaging 0.99
R1996:Kif21a UTSW 15 90,878,574 (GRCm39) nonsense probably null
R2230:Kif21a UTSW 15 90,869,565 (GRCm39) nonsense probably null
R2231:Kif21a UTSW 15 90,869,565 (GRCm39) nonsense probably null
R2232:Kif21a UTSW 15 90,869,565 (GRCm39) nonsense probably null
R2424:Kif21a UTSW 15 90,855,399 (GRCm39) missense probably damaging 1.00
R2429:Kif21a UTSW 15 90,882,208 (GRCm39) missense probably damaging 1.00
R2513:Kif21a UTSW 15 90,878,594 (GRCm39) missense possibly damaging 0.96
R2846:Kif21a UTSW 15 90,818,667 (GRCm39) missense probably benign
R3027:Kif21a UTSW 15 90,856,845 (GRCm39) missense probably damaging 0.99
R3624:Kif21a UTSW 15 90,849,798 (GRCm39) missense probably damaging 0.99
R3820:Kif21a UTSW 15 90,852,277 (GRCm39) missense probably benign 0.17
R3923:Kif21a UTSW 15 90,821,497 (GRCm39) missense possibly damaging 0.46
R3962:Kif21a UTSW 15 90,869,612 (GRCm39) missense probably damaging 1.00
R4355:Kif21a UTSW 15 90,855,036 (GRCm39) missense probably benign 0.17
R4516:Kif21a UTSW 15 90,855,345 (GRCm39) missense probably benign 0.38
R4530:Kif21a UTSW 15 90,852,292 (GRCm39) splice site probably null
R4612:Kif21a UTSW 15 90,852,426 (GRCm39) splice site probably null
R4674:Kif21a UTSW 15 90,824,748 (GRCm39) missense possibly damaging 0.66
R4675:Kif21a UTSW 15 90,824,748 (GRCm39) missense possibly damaging 0.66
R4698:Kif21a UTSW 15 90,840,508 (GRCm39) missense possibly damaging 0.85
R4712:Kif21a UTSW 15 90,868,958 (GRCm39) missense probably damaging 1.00
R4955:Kif21a UTSW 15 90,821,393 (GRCm39) missense probably damaging 1.00
R4974:Kif21a UTSW 15 90,833,213 (GRCm39) missense probably benign 0.16
R5034:Kif21a UTSW 15 90,852,561 (GRCm39) missense probably null 1.00
R5165:Kif21a UTSW 15 90,840,579 (GRCm39) missense probably benign 0.38
R5464:Kif21a UTSW 15 90,878,058 (GRCm39) missense probably damaging 1.00
R5541:Kif21a UTSW 15 90,852,316 (GRCm39) missense probably damaging 0.99
R5757:Kif21a UTSW 15 90,835,548 (GRCm39) missense probably damaging 1.00
R5936:Kif21a UTSW 15 90,819,850 (GRCm39) missense possibly damaging 0.95
R5976:Kif21a UTSW 15 90,820,015 (GRCm39) missense probably damaging 1.00
R6074:Kif21a UTSW 15 90,865,095 (GRCm39) missense probably benign
R6638:Kif21a UTSW 15 90,850,610 (GRCm39) missense probably damaging 1.00
R6723:Kif21a UTSW 15 90,824,649 (GRCm39) missense probably damaging 0.97
R6785:Kif21a UTSW 15 90,819,933 (GRCm39) missense probably damaging 1.00
R6977:Kif21a UTSW 15 90,865,040 (GRCm39) missense probably damaging 1.00
R7058:Kif21a UTSW 15 90,833,106 (GRCm39) splice site probably null
R7147:Kif21a UTSW 15 90,865,086 (GRCm39) missense probably benign 0.13
R7290:Kif21a UTSW 15 90,851,432 (GRCm39) nonsense probably null
R7438:Kif21a UTSW 15 90,877,999 (GRCm39) missense probably benign 0.37
R7593:Kif21a UTSW 15 90,828,064 (GRCm39) missense probably benign 0.03
R7661:Kif21a UTSW 15 90,865,122 (GRCm39) missense possibly damaging 0.89
R7891:Kif21a UTSW 15 90,840,517 (GRCm39) missense probably damaging 1.00
R8137:Kif21a UTSW 15 90,852,645 (GRCm39) missense probably benign
R8182:Kif21a UTSW 15 90,819,964 (GRCm39) missense possibly damaging 0.77
R8303:Kif21a UTSW 15 90,855,399 (GRCm39) missense probably damaging 0.99
R8388:Kif21a UTSW 15 90,843,327 (GRCm39) missense possibly damaging 0.60
R8867:Kif21a UTSW 15 90,852,382 (GRCm39) missense probably damaging 0.96
R8921:Kif21a UTSW 15 90,855,930 (GRCm39) missense probably benign 0.04
R8984:Kif21a UTSW 15 90,840,559 (GRCm39) missense probably benign 0.00
R9024:Kif21a UTSW 15 90,821,399 (GRCm39) nonsense probably null
R9254:Kif21a UTSW 15 90,854,030 (GRCm39) missense probably damaging 0.99
R9366:Kif21a UTSW 15 90,843,951 (GRCm39) missense probably damaging 0.99
R9379:Kif21a UTSW 15 90,854,030 (GRCm39) missense probably damaging 0.99
R9393:Kif21a UTSW 15 90,853,981 (GRCm39) missense probably benign 0.00
R9518:Kif21a UTSW 15 90,840,676 (GRCm39) missense probably damaging 1.00
R9712:Kif21a UTSW 15 90,879,715 (GRCm39) missense probably benign 0.13
R9712:Kif21a UTSW 15 90,869,528 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TATTTAGAGACTCGGAACACCC -3'
(R):5'- GGGCCGTGATGATCTTTCAG -3'

Sequencing Primer
(F):5'- CAGTTCCTGGGACACAATGATGC -3'
(R):5'- GATGATCTTTCAGCCTACTTTCGGG -3'
Posted On 2022-10-06