Incidental Mutation 'R9721:Tsc2'
ID 730816
Institutional Source Beutler Lab
Gene Symbol Tsc2
Ensembl Gene ENSMUSG00000002496
Gene Name TSC complex subunit 2
Synonyms tuberin, Nafld, tuberous sclerosis 2
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 24814790-24851604 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 24818616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1408 (R1408*)
Ref Sequence ENSEMBL: ENSMUSP00000094986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035565] [ENSMUST00000097373] [ENSMUST00000226284] [ENSMUST00000226398] [ENSMUST00000227607] [ENSMUST00000227745] [ENSMUST00000227804] [ENSMUST00000228412]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035565
SMART Domains Protein: ENSMUSP00000049296
Gene: ENSMUSG00000032855

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 32 71 1.61e-8 SMART
LRR_TYP 90 113 2.47e-5 SMART
LRRCT 125 177 3.84e-12 SMART
WSC 177 271 6.93e-34 SMART
PKD 272 355 2.72e-15 SMART
CLECT 406 530 5.72e-20 SMART
low complexity region 545 558 N/A INTRINSIC
low complexity region 763 788 N/A INTRINSIC
PKD 930 1008 1.06e-8 SMART
PKD 1015 1119 2.26e-12 SMART
PKD 1122 1205 2.03e-14 SMART
PKD 1208 1288 1.14e-17 SMART
PKD 1290 1373 2.35e-10 SMART
PKD 1374 1459 7.63e-10 SMART
PKD 1464 1541 1.95e-16 SMART
PKD 1544 1625 1.05e-16 SMART
PKD 1631 1714 1.93e-1 SMART
PKD 1716 1798 2.21e-15 SMART
PKD 1799 1882 5.7e-9 SMART
PKD 1884 1964 1.56e-6 SMART
PKD 1968 2056 3.1e-10 SMART
PKD 2057 2140 1.74e-13 SMART
Pfam:REJ 2167 2610 1e-108 PFAM
low complexity region 2697 2706 N/A INTRINSIC
GPS 3003 3052 1.33e-12 SMART
transmembrane domain 3065 3087 N/A INTRINSIC
LH2 3110 3224 3.5e-18 SMART
transmembrane domain 3275 3294 N/A INTRINSIC
transmembrane domain 3314 3336 N/A INTRINSIC
low complexity region 3357 3378 N/A INTRINSIC
low complexity region 3479 3492 N/A INTRINSIC
transmembrane domain 3547 3569 N/A INTRINSIC
low complexity region 3573 3591 N/A INTRINSIC
low complexity region 3626 3639 N/A INTRINSIC
low complexity region 3661 3676 N/A INTRINSIC
Pfam:PKD_channel 3701 4103 7.1e-125 PFAM
low complexity region 4153 4172 N/A INTRINSIC
low complexity region 4238 4256 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097373
AA Change: R1408*
SMART Domains Protein: ENSMUSP00000094986
Gene: ENSMUSG00000002496
AA Change: R1408*

DomainStartEndE-ValueType
Pfam:DUF3384 54 470 4e-103 PFAM
Pfam:Tuberin 555 903 5.9e-149 PFAM
low complexity region 1023 1054 N/A INTRINSIC
low complexity region 1271 1278 N/A INTRINSIC
low complexity region 1310 1328 N/A INTRINSIC
low complexity region 1330 1344 N/A INTRINSIC
low complexity region 1378 1398 N/A INTRINSIC
Pfam:Rap_GAP 1497 1685 1.3e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226284
AA Change: R1451*
Predicted Effect probably null
Transcript: ENSMUST00000226398
AA Change: R1408*
Predicted Effect probably benign
Transcript: ENSMUST00000227107
Predicted Effect probably null
Transcript: ENSMUST00000227607
AA Change: R1349*
Predicted Effect probably null
Transcript: ENSMUST00000227745
AA Change: R1474*
Predicted Effect probably benign
Transcript: ENSMUST00000227804
Predicted Effect probably null
Transcript: ENSMUST00000228412
AA Change: R1407*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene lead to tuberous sclerosis complex. Its gene product is believed to be a tumor suppressor and is able to stimulate specific GTPases. The protein associates with hamartin in a cytosolic complex, possibly acting as a chaperone for hamartin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit liver hypoplasia, open neural tube, thickened myocardium and die by embryonic day 9.5-12.5. Heterozygotes develop renal cystadenomas, liver hemangiomas (sometimes resulting in fatal bleeding) and lung adenomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,212,932 (GRCm39) Y120N probably benign Het
AAdacl4fm3 A T 4: 144,429,942 (GRCm39) V349D possibly damaging Het
Alox8 T A 11: 69,087,911 (GRCm39) H131L probably benign Het
Atp13a1 A G 8: 70,252,087 (GRCm39) E588G probably damaging Het
AU040320 G A 4: 126,733,441 (GRCm39) V654M probably damaging Het
Bicra A G 7: 15,713,101 (GRCm39) L982P probably damaging Het
Cdh11 A T 8: 103,406,257 (GRCm39) V72E probably damaging Het
Cfap65 T C 1: 74,958,501 (GRCm39) T869A probably benign Het
Cplane1 A G 15: 8,254,893 (GRCm39) T27A unknown Het
Ddx19a A G 8: 111,705,107 (GRCm39) F338S probably damaging Het
Dhrs7c T A 11: 67,705,904 (GRCm39) V219E probably damaging Het
Dhx33 A G 11: 70,892,424 (GRCm39) V115A probably damaging Het
Dst A G 1: 34,231,866 (GRCm39) D3153G probably benign Het
Ecpas A T 4: 58,850,938 (GRCm39) S412T probably benign Het
Eif5b T C 1: 38,076,740 (GRCm39) probably null Het
Ep300 A G 15: 81,492,516 (GRCm39) N284S unknown Het
Fam83a A G 15: 57,849,513 (GRCm39) N19S probably benign Het
Fgd5 A T 6: 91,965,278 (GRCm39) T504S probably benign Het
Flt4 G A 11: 49,535,260 (GRCm39) probably null Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Gls A G 1: 52,251,427 (GRCm39) V310A probably damaging Het
Gm5414 A T 15: 101,536,582 (GRCm39) C14* probably null Het
Gm9887 C G 12: 69,418,629 (GRCm39) A202P unknown Het
Ifi214 T C 1: 173,355,479 (GRCm39) T110A possibly damaging Het
Il4i1 A G 7: 44,489,113 (GRCm39) R293G probably benign Het
Itpr1 A T 6: 108,383,063 (GRCm39) T1464S probably damaging Het
Kif18a T C 2: 109,123,400 (GRCm39) S225P probably damaging Het
Kif21a A T 15: 90,855,330 (GRCm39) I678N probably damaging Het
Klf11 T A 12: 24,710,240 (GRCm39) D429E probably damaging Het
Kntc1 A G 5: 123,939,948 (GRCm39) T1581A probably benign Het
Lama2 T C 10: 27,343,338 (GRCm39) N45D possibly damaging Het
Lrrk1 T C 7: 65,924,623 (GRCm39) I1319V probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Malrd1 C T 2: 15,701,638 (GRCm39) T751I unknown Het
Matcap1 A T 8: 106,009,820 (GRCm39) D376E probably benign Het
Mgat5b T C 11: 116,857,595 (GRCm39) L363P probably damaging Het
Mphosph9 A T 5: 124,436,738 (GRCm39) S535R possibly damaging Het
Nckap5 C T 1: 125,955,017 (GRCm39) D512N probably damaging Het
Ngef T A 1: 87,406,857 (GRCm39) D637V probably damaging Het
Nup93 T C 8: 95,030,313 (GRCm39) Y391H probably damaging Het
Or10j7 C A 1: 173,011,915 (GRCm39) V29F probably benign Het
Or4c110 T C 2: 88,832,060 (GRCm39) T191A Het
Or5b3 A T 19: 13,388,334 (GRCm39) T134S probably benign Het
Pcdhb4 C A 18: 37,442,905 (GRCm39) D738E possibly damaging Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Phactr3 G A 2: 177,898,043 (GRCm39) E86K probably damaging Het
Psd C T 19: 46,311,628 (GRCm39) D351N probably benign Het
Pzp A G 6: 128,472,154 (GRCm39) probably null Het
Rerg T A 6: 137,033,415 (GRCm39) K106* probably null Het
Samd9l T C 6: 3,375,854 (GRCm39) E469G possibly damaging Het
Smok2b C A 17: 13,453,865 (GRCm39) Y8* probably null Het
Spata31e3 T C 13: 50,400,688 (GRCm39) Y546C possibly damaging Het
Spn A G 7: 126,735,437 (GRCm39) S357P probably benign Het
Tek T G 4: 94,692,539 (GRCm39) W216G possibly damaging Het
Trpm3 A T 19: 22,866,762 (GRCm39) H531L probably benign Het
Trpm6 A G 19: 18,807,336 (GRCm39) M1027V probably benign Het
Tut4 T A 4: 108,412,778 (GRCm39) M1493K probably benign Het
Unc13b A G 4: 43,101,869 (GRCm39) N155D probably benign Het
Vmn1r52 G A 6: 90,156,008 (GRCm39) C104Y probably damaging Het
Xylt1 A T 7: 117,148,255 (GRCm39) E273V probably damaging Het
Zc3h4 C A 7: 16,168,770 (GRCm39) Q1035K unknown Het
Zfp14 A T 7: 29,738,609 (GRCm39) S125R probably benign Het
Other mutations in Tsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Tsc2 APN 17 24,827,081 (GRCm39) missense probably damaging 1.00
IGL00985:Tsc2 APN 17 24,816,105 (GRCm39) missense probably damaging 1.00
IGL01386:Tsc2 APN 17 24,832,259 (GRCm39) missense probably damaging 1.00
IGL01468:Tsc2 APN 17 24,840,071 (GRCm39) missense possibly damaging 0.90
IGL01530:Tsc2 APN 17 24,841,636 (GRCm39) missense possibly damaging 0.76
IGL02390:Tsc2 APN 17 24,819,427 (GRCm39) missense probably damaging 1.00
IGL02398:Tsc2 APN 17 24,840,703 (GRCm39) missense probably damaging 1.00
IGL02741:Tsc2 APN 17 24,848,943 (GRCm39) missense probably damaging 1.00
IGL03191:Tsc2 APN 17 24,847,028 (GRCm39) missense probably damaging 1.00
IGL03372:Tsc2 APN 17 24,838,444 (GRCm39) missense probably damaging 1.00
IGL03412:Tsc2 APN 17 24,816,042 (GRCm39) missense probably damaging 0.98
Twitch UTSW 17 24,815,716 (GRCm39) splice site probably null
PIT4515001:Tsc2 UTSW 17 24,840,121 (GRCm39) missense probably benign 0.15
R0025:Tsc2 UTSW 17 24,849,978 (GRCm39) splice site probably benign
R0025:Tsc2 UTSW 17 24,849,978 (GRCm39) splice site probably benign
R0138:Tsc2 UTSW 17 24,818,600 (GRCm39) missense possibly damaging 0.65
R0540:Tsc2 UTSW 17 24,840,686 (GRCm39) missense probably damaging 1.00
R0570:Tsc2 UTSW 17 24,845,701 (GRCm39) missense probably damaging 1.00
R0607:Tsc2 UTSW 17 24,840,686 (GRCm39) missense probably damaging 1.00
R0826:Tsc2 UTSW 17 24,815,932 (GRCm39) missense probably benign 0.04
R1430:Tsc2 UTSW 17 24,817,997 (GRCm39) critical splice donor site probably null
R1440:Tsc2 UTSW 17 24,833,366 (GRCm39) missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24,827,947 (GRCm39) missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24,827,947 (GRCm39) missense probably damaging 1.00
R1541:Tsc2 UTSW 17 24,850,950 (GRCm39) missense probably damaging 1.00
R1717:Tsc2 UTSW 17 24,816,042 (GRCm39) missense probably damaging 0.98
R1799:Tsc2 UTSW 17 24,823,382 (GRCm39) missense probably benign
R2030:Tsc2 UTSW 17 24,842,444 (GRCm39) splice site probably benign
R2147:Tsc2 UTSW 17 24,840,116 (GRCm39) missense possibly damaging 0.62
R2888:Tsc2 UTSW 17 24,850,969 (GRCm39) critical splice donor site probably null
R3609:Tsc2 UTSW 17 24,841,524 (GRCm39) missense possibly damaging 0.74
R3610:Tsc2 UTSW 17 24,841,524 (GRCm39) missense possibly damaging 0.74
R3811:Tsc2 UTSW 17 24,848,011 (GRCm39) missense probably benign 0.09
R3895:Tsc2 UTSW 17 24,818,786 (GRCm39) missense probably damaging 1.00
R3962:Tsc2 UTSW 17 24,840,140 (GRCm39) splice site probably benign
R3971:Tsc2 UTSW 17 24,842,562 (GRCm39) missense probably damaging 1.00
R4018:Tsc2 UTSW 17 24,844,255 (GRCm39) missense probably damaging 0.99
R4184:Tsc2 UTSW 17 24,850,990 (GRCm39) missense probably benign 0.43
R4435:Tsc2 UTSW 17 24,818,687 (GRCm39) missense probably benign 0.01
R4437:Tsc2 UTSW 17 24,818,687 (GRCm39) missense probably benign 0.01
R4474:Tsc2 UTSW 17 24,816,238 (GRCm39) missense probably damaging 0.98
R4703:Tsc2 UTSW 17 24,823,883 (GRCm39) missense probably benign 0.13
R4731:Tsc2 UTSW 17 24,822,249 (GRCm39) missense possibly damaging 0.72
R4732:Tsc2 UTSW 17 24,822,249 (GRCm39) missense possibly damaging 0.72
R4733:Tsc2 UTSW 17 24,822,249 (GRCm39) missense possibly damaging 0.72
R4817:Tsc2 UTSW 17 24,815,716 (GRCm39) splice site probably null
R4890:Tsc2 UTSW 17 24,819,009 (GRCm39) missense probably damaging 1.00
R4922:Tsc2 UTSW 17 24,819,343 (GRCm39) missense probably benign 0.22
R5119:Tsc2 UTSW 17 24,822,254 (GRCm39) missense probably benign 0.00
R5393:Tsc2 UTSW 17 24,819,370 (GRCm39) missense possibly damaging 0.89
R5785:Tsc2 UTSW 17 24,818,861 (GRCm39) splice site probably null
R5838:Tsc2 UTSW 17 24,832,190 (GRCm39) missense probably benign 0.01
R5857:Tsc2 UTSW 17 24,818,981 (GRCm39) missense probably damaging 0.99
R5911:Tsc2 UTSW 17 24,819,361 (GRCm39) missense possibly damaging 0.63
R5988:Tsc2 UTSW 17 24,839,740 (GRCm39) missense probably damaging 1.00
R6275:Tsc2 UTSW 17 24,819,394 (GRCm39) missense probably benign 0.00
R6290:Tsc2 UTSW 17 24,815,884 (GRCm39) missense probably benign 0.04
R6371:Tsc2 UTSW 17 24,845,688 (GRCm39) missense probably benign 0.00
R6467:Tsc2 UTSW 17 24,828,101 (GRCm39) missense probably benign 0.04
R6577:Tsc2 UTSW 17 24,829,473 (GRCm39) missense probably damaging 1.00
R6728:Tsc2 UTSW 17 24,840,098 (GRCm39) missense probably damaging 1.00
R6918:Tsc2 UTSW 17 24,832,203 (GRCm39) missense probably damaging 1.00
R6995:Tsc2 UTSW 17 24,847,028 (GRCm39) missense probably damaging 1.00
R7026:Tsc2 UTSW 17 24,845,713 (GRCm39) missense probably damaging 0.99
R7136:Tsc2 UTSW 17 24,832,254 (GRCm39) missense probably benign 0.00
R7236:Tsc2 UTSW 17 24,842,568 (GRCm39) missense possibly damaging 0.82
R7243:Tsc2 UTSW 17 24,818,604 (GRCm39) missense probably benign 0.02
R7249:Tsc2 UTSW 17 24,826,729 (GRCm39) missense probably damaging 1.00
R7450:Tsc2 UTSW 17 24,819,005 (GRCm39) missense probably damaging 1.00
R7522:Tsc2 UTSW 17 24,849,939 (GRCm39) missense probably damaging 1.00
R7529:Tsc2 UTSW 17 24,816,922 (GRCm39) missense probably damaging 0.98
R7637:Tsc2 UTSW 17 24,826,466 (GRCm39) missense probably benign 0.13
R7781:Tsc2 UTSW 17 24,827,089 (GRCm39) missense possibly damaging 0.52
R8005:Tsc2 UTSW 17 24,818,570 (GRCm39) missense probably damaging 0.98
R8262:Tsc2 UTSW 17 24,833,340 (GRCm39) missense probably benign 0.06
R8268:Tsc2 UTSW 17 24,818,984 (GRCm39) missense probably benign 0.44
R8400:Tsc2 UTSW 17 24,823,961 (GRCm39) missense possibly damaging 0.62
R9020:Tsc2 UTSW 17 24,845,691 (GRCm39) missense probably damaging 0.99
R9039:Tsc2 UTSW 17 24,826,489 (GRCm39) missense probably benign 0.01
R9065:Tsc2 UTSW 17 24,822,164 (GRCm39) missense probably benign 0.39
R9123:Tsc2 UTSW 17 24,823,802 (GRCm39) missense probably null 0.40
R9125:Tsc2 UTSW 17 24,823,802 (GRCm39) missense probably null 0.40
R9186:Tsc2 UTSW 17 24,823,862 (GRCm39) missense probably damaging 1.00
R9390:Tsc2 UTSW 17 24,823,824 (GRCm39) missense probably damaging 1.00
R9542:Tsc2 UTSW 17 24,819,308 (GRCm39) critical splice donor site probably null
Z1177:Tsc2 UTSW 17 24,839,753 (GRCm39) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TTCTCCCGTGCAGTGTATGG -3'
(R):5'- ACAGGACATCCTTGGAGACC -3'

Sequencing Primer
(F):5'- GCAGTGTATGGGAGCTCC -3'
(R):5'- ACATCCTTGGAGACCTAGGG -3'
Posted On 2022-10-06