Incidental Mutation 'R9721:Pcdhb4'
ID 730817
Institutional Source Beutler Lab
Gene Symbol Pcdhb4
Ensembl Gene ENSMUSG00000045689
Gene Name protocadherin beta 4
Synonyms PcdhbD, Pcdhb5A
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9721 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 37440508-37444225 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 37442905 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 738 (D738E)
Ref Sequence ENSEMBL: ENSMUSP00000059770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056712] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q91XZ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000056712
AA Change: D738E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000059770
Gene: ENSMUSG00000045689
AA Change: D738E

DomainStartEndE-ValueType
CA 54 131 1.66e0 SMART
CA 155 240 1.07e-19 SMART
CA 264 344 6.03e-28 SMART
CA 367 448 2.57e-22 SMART
CA 472 558 3.36e-26 SMART
CA 588 669 3.48e-10 SMART
Pfam:Cadherin_C_2 685 768 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,212,932 (GRCm39) Y120N probably benign Het
AAdacl4fm3 A T 4: 144,429,942 (GRCm39) V349D possibly damaging Het
Alox8 T A 11: 69,087,911 (GRCm39) H131L probably benign Het
Atp13a1 A G 8: 70,252,087 (GRCm39) E588G probably damaging Het
AU040320 G A 4: 126,733,441 (GRCm39) V654M probably damaging Het
Bicra A G 7: 15,713,101 (GRCm39) L982P probably damaging Het
Cdh11 A T 8: 103,406,257 (GRCm39) V72E probably damaging Het
Cfap65 T C 1: 74,958,501 (GRCm39) T869A probably benign Het
Cplane1 A G 15: 8,254,893 (GRCm39) T27A unknown Het
Ddx19a A G 8: 111,705,107 (GRCm39) F338S probably damaging Het
Dhrs7c T A 11: 67,705,904 (GRCm39) V219E probably damaging Het
Dhx33 A G 11: 70,892,424 (GRCm39) V115A probably damaging Het
Dst A G 1: 34,231,866 (GRCm39) D3153G probably benign Het
Ecpas A T 4: 58,850,938 (GRCm39) S412T probably benign Het
Eif5b T C 1: 38,076,740 (GRCm39) probably null Het
Ep300 A G 15: 81,492,516 (GRCm39) N284S unknown Het
Fam83a A G 15: 57,849,513 (GRCm39) N19S probably benign Het
Fgd5 A T 6: 91,965,278 (GRCm39) T504S probably benign Het
Flt4 G A 11: 49,535,260 (GRCm39) probably null Het
Ggta1 G T 2: 35,303,418 (GRCm39) D91E probably benign Het
Gls A G 1: 52,251,427 (GRCm39) V310A probably damaging Het
Gm5414 A T 15: 101,536,582 (GRCm39) C14* probably null Het
Gm9887 C G 12: 69,418,629 (GRCm39) A202P unknown Het
Ifi214 T C 1: 173,355,479 (GRCm39) T110A possibly damaging Het
Il4i1 A G 7: 44,489,113 (GRCm39) R293G probably benign Het
Itpr1 A T 6: 108,383,063 (GRCm39) T1464S probably damaging Het
Kif18a T C 2: 109,123,400 (GRCm39) S225P probably damaging Het
Kif21a A T 15: 90,855,330 (GRCm39) I678N probably damaging Het
Klf11 T A 12: 24,710,240 (GRCm39) D429E probably damaging Het
Kntc1 A G 5: 123,939,948 (GRCm39) T1581A probably benign Het
Lama2 T C 10: 27,343,338 (GRCm39) N45D possibly damaging Het
Lrrk1 T C 7: 65,924,623 (GRCm39) I1319V probably damaging Het
Ltbr G A 6: 125,284,348 (GRCm39) R365W probably damaging Het
Malrd1 C T 2: 15,701,638 (GRCm39) T751I unknown Het
Matcap1 A T 8: 106,009,820 (GRCm39) D376E probably benign Het
Mgat5b T C 11: 116,857,595 (GRCm39) L363P probably damaging Het
Mphosph9 A T 5: 124,436,738 (GRCm39) S535R possibly damaging Het
Nckap5 C T 1: 125,955,017 (GRCm39) D512N probably damaging Het
Ngef T A 1: 87,406,857 (GRCm39) D637V probably damaging Het
Nup93 T C 8: 95,030,313 (GRCm39) Y391H probably damaging Het
Or10j7 C A 1: 173,011,915 (GRCm39) V29F probably benign Het
Or4c110 T C 2: 88,832,060 (GRCm39) T191A Het
Or5b3 A T 19: 13,388,334 (GRCm39) T134S probably benign Het
Pfpl G C 19: 12,406,297 (GRCm39) E183Q probably damaging Het
Phactr3 G A 2: 177,898,043 (GRCm39) E86K probably damaging Het
Psd C T 19: 46,311,628 (GRCm39) D351N probably benign Het
Pzp A G 6: 128,472,154 (GRCm39) probably null Het
Rerg T A 6: 137,033,415 (GRCm39) K106* probably null Het
Samd9l T C 6: 3,375,854 (GRCm39) E469G possibly damaging Het
Smok2b C A 17: 13,453,865 (GRCm39) Y8* probably null Het
Spata31e3 T C 13: 50,400,688 (GRCm39) Y546C possibly damaging Het
Spn A G 7: 126,735,437 (GRCm39) S357P probably benign Het
Tek T G 4: 94,692,539 (GRCm39) W216G possibly damaging Het
Trpm3 A T 19: 22,866,762 (GRCm39) H531L probably benign Het
Trpm6 A G 19: 18,807,336 (GRCm39) M1027V probably benign Het
Tsc2 G A 17: 24,818,616 (GRCm39) R1408* probably null Het
Tut4 T A 4: 108,412,778 (GRCm39) M1493K probably benign Het
Unc13b A G 4: 43,101,869 (GRCm39) N155D probably benign Het
Vmn1r52 G A 6: 90,156,008 (GRCm39) C104Y probably damaging Het
Xylt1 A T 7: 117,148,255 (GRCm39) E273V probably damaging Het
Zc3h4 C A 7: 16,168,770 (GRCm39) Q1035K unknown Het
Zfp14 A T 7: 29,738,609 (GRCm39) S125R probably benign Het
Other mutations in Pcdhb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Pcdhb4 APN 18 37,442,969 (GRCm39) missense possibly damaging 0.68
IGL01319:Pcdhb4 APN 18 37,441,566 (GRCm39) missense probably benign
IGL01325:Pcdhb4 APN 18 37,442,676 (GRCm39) missense probably damaging 1.00
IGL01608:Pcdhb4 APN 18 37,441,803 (GRCm39) missense probably damaging 1.00
IGL01808:Pcdhb4 APN 18 37,442,067 (GRCm39) missense probably damaging 1.00
IGL01962:Pcdhb4 APN 18 37,442,057 (GRCm39) missense possibly damaging 0.90
IGL02280:Pcdhb4 APN 18 37,440,735 (GRCm39) missense probably benign 0.00
IGL02622:Pcdhb4 APN 18 37,442,721 (GRCm39) missense probably benign 0.00
IGL03025:Pcdhb4 APN 18 37,443,030 (GRCm39) missense possibly damaging 0.62
IGL03137:Pcdhb4 APN 18 37,441,569 (GRCm39) missense probably damaging 0.98
P0031:Pcdhb4 UTSW 18 37,441,938 (GRCm39) missense probably damaging 1.00
R0385:Pcdhb4 UTSW 18 37,442,268 (GRCm39) missense probably damaging 1.00
R0611:Pcdhb4 UTSW 18 37,441,263 (GRCm39) missense probably damaging 1.00
R0671:Pcdhb4 UTSW 18 37,440,795 (GRCm39) missense probably benign 0.01
R0738:Pcdhb4 UTSW 18 37,441,764 (GRCm39) missense probably damaging 1.00
R0853:Pcdhb4 UTSW 18 37,442,938 (GRCm39) nonsense probably null
R0893:Pcdhb4 UTSW 18 37,442,423 (GRCm39) splice site probably null
R1932:Pcdhb4 UTSW 18 37,442,594 (GRCm39) missense probably benign 0.33
R1945:Pcdhb4 UTSW 18 37,441,921 (GRCm39) missense probably damaging 1.00
R2194:Pcdhb4 UTSW 18 37,441,788 (GRCm39) missense probably damaging 1.00
R2273:Pcdhb4 UTSW 18 37,441,979 (GRCm39) missense probably damaging 1.00
R3807:Pcdhb4 UTSW 18 37,442,367 (GRCm39) missense probably damaging 0.98
R3815:Pcdhb4 UTSW 18 37,441,065 (GRCm39) missense probably damaging 1.00
R3816:Pcdhb4 UTSW 18 37,441,065 (GRCm39) missense probably damaging 1.00
R3974:Pcdhb4 UTSW 18 37,441,901 (GRCm39) missense possibly damaging 0.55
R4558:Pcdhb4 UTSW 18 37,443,017 (GRCm39) missense probably benign
R4606:Pcdhb4 UTSW 18 37,441,705 (GRCm39) missense probably damaging 1.00
R4615:Pcdhb4 UTSW 18 37,441,553 (GRCm39) missense probably benign 0.02
R4840:Pcdhb4 UTSW 18 37,441,452 (GRCm39) missense possibly damaging 0.60
R5240:Pcdhb4 UTSW 18 37,442,979 (GRCm39) missense possibly damaging 0.78
R5272:Pcdhb4 UTSW 18 37,440,819 (GRCm39) missense probably benign 0.04
R5586:Pcdhb4 UTSW 18 37,442,034 (GRCm39) missense probably damaging 1.00
R5683:Pcdhb4 UTSW 18 37,442,042 (GRCm39) missense probably benign 0.45
R5917:Pcdhb4 UTSW 18 37,442,619 (GRCm39) missense probably damaging 1.00
R6110:Pcdhb4 UTSW 18 37,441,482 (GRCm39) missense possibly damaging 0.80
R6383:Pcdhb4 UTSW 18 37,441,074 (GRCm39) missense probably damaging 1.00
R6877:Pcdhb4 UTSW 18 37,442,625 (GRCm39) missense probably damaging 1.00
R7036:Pcdhb4 UTSW 18 37,441,835 (GRCm39) missense possibly damaging 0.95
R7204:Pcdhb4 UTSW 18 37,442,292 (GRCm39) missense probably damaging 1.00
R7271:Pcdhb4 UTSW 18 37,441,222 (GRCm39) missense possibly damaging 0.89
R7436:Pcdhb4 UTSW 18 37,442,328 (GRCm39) missense probably damaging 1.00
R7444:Pcdhb4 UTSW 18 37,442,505 (GRCm39) missense probably damaging 1.00
R7614:Pcdhb4 UTSW 18 37,442,602 (GRCm39) missense probably benign 0.40
R7650:Pcdhb4 UTSW 18 37,442,667 (GRCm39) missense probably damaging 1.00
R7664:Pcdhb4 UTSW 18 37,442,293 (GRCm39) missense probably damaging 1.00
R8080:Pcdhb4 UTSW 18 37,442,349 (GRCm39) missense probably benign 0.42
R8087:Pcdhb4 UTSW 18 37,441,717 (GRCm39) missense probably damaging 1.00
R8115:Pcdhb4 UTSW 18 37,442,453 (GRCm39) missense probably damaging 0.99
R8697:Pcdhb4 UTSW 18 37,441,832 (GRCm39) missense probably benign 0.15
R8815:Pcdhb4 UTSW 18 37,442,055 (GRCm39) missense probably damaging 1.00
R9008:Pcdhb4 UTSW 18 37,440,714 (GRCm39) missense probably benign
R9225:Pcdhb4 UTSW 18 37,441,695 (GRCm39) missense possibly damaging 0.68
R9278:Pcdhb4 UTSW 18 37,441,925 (GRCm39) missense possibly damaging 0.61
R9299:Pcdhb4 UTSW 18 37,442,264 (GRCm39) missense probably benign 0.02
R9390:Pcdhb4 UTSW 18 37,442,781 (GRCm39) missense possibly damaging 0.80
R9582:Pcdhb4 UTSW 18 37,441,417 (GRCm39) missense probably damaging 1.00
R9686:Pcdhb4 UTSW 18 37,442,943 (GRCm39) missense probably damaging 0.98
Z1177:Pcdhb4 UTSW 18 37,442,966 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAATGCACGTGCTAGTGGTG -3'
(R):5'- CCAAGCAACTATGACTTATCCTTC -3'

Sequencing Primer
(F):5'- GCTGGATCCTACACGGGAAG -3'
(R):5'- AGCAACTATGACTTATCCTTCTCTTG -3'
Posted On 2022-10-06