Incidental Mutation 'R9722:Sgsm1'
ID 730846
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, 2410098H20Rik, D5Bwg1524e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9722 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 113243220-113310786 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 113280341 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 327 (H327L)
Ref Sequence ENSEMBL: ENSMUSP00000046544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209] [ENSMUST00000112324] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000048112
AA Change: H327L

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: H327L

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000057209
AA Change: H40L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216
AA Change: H40L

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
TBC 272 766 2.88e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112324
AA Change: H40L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107943
Gene: ENSMUSG00000042216
AA Change: H40L

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112325
AA Change: H327L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216
AA Change: H327L

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154248
AA Change: H327L

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216
AA Change: H327L

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A T 10: 29,218,273 I52F probably benign Het
Abcc3 A T 11: 94,359,246 L1017Q probably damaging Het
Antxr2 T C 5: 97,948,327 D366G possibly damaging Het
Astn2 C T 4: 65,913,741 V563I probably benign Het
Atrn C A 2: 130,961,616 D575E probably damaging Het
Baz1a C T 12: 54,900,097 D1228N probably benign Het
Canx A G 11: 50,304,474 S256P probably benign Het
Ccnt2 T A 1: 127,802,188 D267E probably damaging Het
Cd209c G T 8: 3,945,905 R2S probably benign Het
Cyfip2 T C 11: 46,196,308 T1252A probably benign Het
Dchs2 A G 3: 83,353,994 Y2523C probably benign Het
Dmxl2 G A 9: 54,416,608 P990L probably benign Het
Dnajc9 T C 14: 20,388,211 I108V probably benign Het
Eif2d T C 1: 131,165,211 probably null Het
Ephb2 T C 4: 136,657,457 D881G probably damaging Het
Esr1 A G 10: 5,001,215 N531S probably benign Het
Fbxo2 G A 4: 148,164,426 R125H probably damaging Het
Foxred1 C T 9: 35,206,004 S277N possibly damaging Het
Gemin5 T C 11: 58,150,592 E518G probably damaging Het
Gm17655 A G 5: 110,046,360 Y519H probably benign Het
Igkv4-57-1 A T 6: 69,544,509 W70R probably damaging Het
Krtap4-13 A G 11: 99,809,354 S160P unknown Het
Map3k3 A G 11: 106,142,535 I205V possibly damaging Het
Map3k4 A C 17: 12,271,636 F303V probably benign Het
Mpdz T C 4: 81,386,267 Q132R probably damaging Het
Myo10 T A 15: 25,801,141 V1472E probably damaging Het
Nckap1 G A 2: 80,571,224 Q39* probably null Het
Nog A G 11: 89,301,570 S151P probably damaging Het
Obox6 G A 7: 15,834,906 S15F probably benign Het
Odf2 A G 2: 29,923,582 H647R possibly damaging Het
Olfr821 A G 10: 130,033,631 R2G probably benign Het
Pcdhga11 T C 18: 37,757,345 S469P possibly damaging Het
Pcnx4 T C 12: 72,556,265 Y434H probably damaging Het
Pfpl G C 19: 12,428,933 E183Q probably damaging Het
Pglyrp3 A G 3: 92,031,388 K290R possibly damaging Het
Phactr3 G A 2: 178,256,250 E86K probably damaging Het
Piezo1 A C 8: 122,498,758 L530R Het
Pigg A T 5: 108,347,901 I935F possibly damaging Het
Pofut2 T C 10: 77,266,925 S282P possibly damaging Het
Ppfia1 A G 7: 144,517,665 S337P probably benign Het
Sdr16c5 A T 4: 4,005,595 D246E probably benign Het
Slc39a4 A G 15: 76,616,011 I113T possibly damaging Het
Slc5a7 A G 17: 54,296,957 probably null Het
Snx11 A G 11: 96,771,099 S86P probably benign Het
Srm T A 4: 148,591,788 probably null Het
Tas2r126 T C 6: 42,435,148 I205T possibly damaging Het
Tek T G 4: 94,804,302 W216G possibly damaging Het
Tenm3 A T 8: 48,300,814 S851R probably benign Het
Tnip2 A G 5: 34,496,868 V288A probably benign Het
Tpx2 T A 2: 152,891,556 probably null Het
Trim33 C A 3: 103,353,830 T1115K possibly damaging Het
Tspan13 T A 12: 36,024,018 I40F probably damaging Het
Ube2v2 T C 16: 15,577,035 I91V probably benign Het
Vmn1r22 A T 6: 57,900,646 F115L probably benign Het
Vmn2r7 G A 3: 64,690,986 P717S probably damaging Het
Zan T C 5: 137,389,062 T4910A unknown Het
Zfp599 T A 9: 22,249,445 T475S probably damaging Het
Zfp638 T A 6: 83,946,319 F700I probably damaging Het
Zfp985 A C 4: 147,583,161 K162T possibly damaging Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113245064 missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113276142 missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113276182 splice site probably benign
IGL01602:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113263490 missense probably benign
IGL01920:Sgsm1 APN 5 113273605 missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113286767 splice site probably benign
IGL02387:Sgsm1 APN 5 113253063 missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113286767 splice site probably benign
IGL03177:Sgsm1 APN 5 113250993 missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113285021 missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113255316 missense possibly damaging 0.67
caliente UTSW 5 113280462 intron probably benign
Chili UTSW 5 113258123 intron probably benign
pimiento UTSW 5 113263257 missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113268750 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113288836 missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113279270 splice site probably benign
R0099:Sgsm1 UTSW 5 113274360 splice site probably benign
R0269:Sgsm1 UTSW 5 113286929 critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113263705 missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113288835 missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113263759 missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113310562 missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113245028 missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113285123 splice site probably benign
R0744:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113258842 missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113265874 missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113279485 missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113273711 nonsense probably null
R1473:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113263269 missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113273617 missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113263515 missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113285400 missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113285404 missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113258123 intron probably benign
R4558:Sgsm1 UTSW 5 113258111 intron probably benign
R4610:Sgsm1 UTSW 5 113255307 missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113260047 critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113282626 missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113280462 intron probably benign
R4992:Sgsm1 UTSW 5 113282620 missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113251039 missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113250957 missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113250956 missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113286838 missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113282656 missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113279131 critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113280380 missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113273646 missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113268846 splice site probably null
R7387:Sgsm1 UTSW 5 113263700 missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113274321 missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113279635 splice site probably null
R7624:Sgsm1 UTSW 5 113274335 nonsense probably null
R7632:Sgsm1 UTSW 5 113276082 missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113253024 missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113274327 missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113266330 missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113282644 missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113255268 missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113251011 missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113260092 missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113263418 missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113287231 missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113284995 missense probably damaging 1.00
R9046:Sgsm1 UTSW 5 113288859 missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113282711 missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113280335 missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113274273 missense unknown
R9377:Sgsm1 UTSW 5 113288875 missense probably damaging 1.00
R9461:Sgsm1 UTSW 5 113276032 critical splice donor site probably null
R9662:Sgsm1 UTSW 5 113279231 missense probably benign 0.03
R9726:Sgsm1 UTSW 5 113310552 missense probably benign
Z1177:Sgsm1 UTSW 5 113282710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGAGCTGGCACACTCAG -3'
(R):5'- ACTTGGCAGAGTTGAGCTC -3'

Sequencing Primer
(F):5'- CACTCAGAGAAATAATGCAGTTTGC -3'
(R):5'- GTTGAGCTCCGGTAACTTCATAGAC -3'
Posted On 2022-10-06