Mutagenetix > Incidental Mutation

Incidental Mutation 'R9722:Piezo1'

730856

Institutional Source

Beutler Lab

Gene Symbol

Piezo1

Ensembl Gene

ENSMUSG00000014444

Gene Name

piezo-type mechanosensitive ion channel component 1

Synonyms

Fam38a, Piezo1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9722 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123208437-123278068 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 123225497 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 530 (L530R)

Ref Sequence

ENSEMBL: ENSMUSP00000114584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067252] [ENSMUST00000127664] [ENSMUST00000128383] [ENSMUST00000156333]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000067252
AA Change: L529R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089777
Gene: ENSMUSG00000014444
AA Change: L529R

Domain	Start	End	E-Value	Type
transmembrane domain	5	24	N/A	INTRINSIC
transmembrane domain	29	46	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
transmembrane domain	121	143	N/A	INTRINSIC
low complexity region	156	169	N/A	INTRINSIC
transmembrane domain	211	233	N/A	INTRINSIC
transmembrane domain	248	270	N/A	INTRINSIC
transmembrane domain	316	333	N/A	INTRINSIC
low complexity region	353	368	N/A	INTRINSIC
low complexity region	396	408	N/A	INTRINSIC
transmembrane domain	433	455	N/A	INTRINSIC
transmembrane domain	468	490	N/A	INTRINSIC
transmembrane domain	513	535	N/A	INTRINSIC
internal_repeat_1	541	658	5.31e-5	PROSPERO
transmembrane domain	685	707	N/A	INTRINSIC
low complexity region	738	753	N/A	INTRINSIC
transmembrane domain	817	839	N/A	INTRINSIC
transmembrane domain	844	866	N/A	INTRINSIC
low complexity region	940	952	N/A	INTRINSIC
transmembrane domain	979	1001	N/A	INTRINSIC
transmembrane domain	1005	1022	N/A	INTRINSIC
transmembrane domain	1035	1057	N/A	INTRINSIC
transmembrane domain	1154	1171	N/A	INTRINSIC
transmembrane domain	1178	1197	N/A	INTRINSIC
Pfam:PIEZO	1229	1458	1.1e-97	PFAM
low complexity region	1475	1486	N/A	INTRINSIC
internal_repeat_1	1646	1752	5.31e-5	PROSPERO
low complexity region	1905	1921	N/A	INTRINSIC
transmembrane domain	1976	1998	N/A	INTRINSIC
transmembrane domain	2018	2038	N/A	INTRINSIC
transmembrane domain	2045	2067	N/A	INTRINSIC
transmembrane domain	2077	2094	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2126	2544	3.2e-157	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000128383
AA Change: L91R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116194
Gene: ENSMUSG00000014444
AA Change: L91R

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
transmembrane domain	31	53	N/A	INTRINSIC
transmembrane domain	75	97	N/A	INTRINSIC
transmembrane domain	143	165	N/A	INTRINSIC
transmembrane domain	169	188	N/A	INTRINSIC
transmembrane domain	195	217	N/A	INTRINSIC
transmembrane domain	247	269	N/A	INTRINSIC
low complexity region	300	315	N/A	INTRINSIC
transmembrane domain	379	401	N/A	INTRINSIC
transmembrane domain	406	428	N/A	INTRINSIC
low complexity region	502	514	N/A	INTRINSIC
transmembrane domain	541	563	N/A	INTRINSIC
transmembrane domain	567	584	N/A	INTRINSIC
transmembrane domain	597	619	N/A	INTRINSIC
transmembrane domain	716	733	N/A	INTRINSIC
transmembrane domain	740	759	N/A	INTRINSIC
transmembrane domain	774	796	N/A	INTRINSIC
transmembrane domain	803	820	N/A	INTRINSIC
low complexity region	848	859	N/A	INTRINSIC
coiled coil region	895	926	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148497

SMART Domains

Protein: ENSMUSP00000121725
Gene: ENSMUSG00000014444

Domain	Start	End	E-Value	Type
transmembrane domain	33	55	N/A	INTRINSIC
low complexity region	86	101	N/A	INTRINSIC
transmembrane domain	165	187	N/A	INTRINSIC
low complexity region	288	300	N/A	INTRINSIC
transmembrane domain	351	373	N/A	INTRINSIC
transmembrane domain	386	408	N/A	INTRINSIC
transmembrane domain	505	522	N/A	INTRINSIC
transmembrane domain	529	548	N/A	INTRINSIC
Pfam:PIEZO	580	809	3.2e-98	PFAM
low complexity region	826	837	N/A	INTRINSIC
low complexity region	1003	1020	N/A	INTRINSIC
low complexity region	1046	1063	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000114584
Gene: ENSMUSG00000014444
AA Change: L530R

Domain	Start	End	E-Value	Type
transmembrane domain	5	24	N/A	INTRINSIC
transmembrane domain	29	46	N/A	INTRINSIC
transmembrane domain	59	81	N/A	INTRINSIC
transmembrane domain	121	143	N/A	INTRINSIC
low complexity region	157	170	N/A	INTRINSIC
transmembrane domain	212	234	N/A	INTRINSIC
transmembrane domain	249	271	N/A	INTRINSIC
transmembrane domain	317	334	N/A	INTRINSIC
low complexity region	354	369	N/A	INTRINSIC
low complexity region	397	409	N/A	INTRINSIC
transmembrane domain	434	456	N/A	INTRINSIC
transmembrane domain	469	491	N/A	INTRINSIC
transmembrane domain	514	536	N/A	INTRINSIC
internal_repeat_1	542	659	4.88e-5	PROSPERO
transmembrane domain	686	708	N/A	INTRINSIC
low complexity region	739	754	N/A	INTRINSIC
transmembrane domain	818	840	N/A	INTRINSIC
transmembrane domain	845	867	N/A	INTRINSIC
low complexity region	941	953	N/A	INTRINSIC
transmembrane domain	980	1002	N/A	INTRINSIC
transmembrane domain	1006	1023	N/A	INTRINSIC
transmembrane domain	1036	1058	N/A	INTRINSIC
transmembrane domain	1155	1172	N/A	INTRINSIC
transmembrane domain	1179	1198	N/A	INTRINSIC
Pfam:PIEZO	1230	1459	2.3e-94	PFAM
low complexity region	1476	1487	N/A	INTRINSIC
internal_repeat_1	1647	1753	4.88e-5	PROSPERO
low complexity region	1906	1922	N/A	INTRINSIC
transmembrane domain	1977	1999	N/A	INTRINSIC
transmembrane domain	2019	2039	N/A	INTRINSIC
transmembrane domain	2046	2068	N/A	INTRINSIC
transmembrane domain	2078	2095	N/A	INTRINSIC
Pfam:Piezo_RRas_bdg	2127	2545	8.7e-154	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mechanically-activated ion channel that links mechanical forces to biological signals. The encoded protein contains 36 transmembrane domains and functions as a homotetramer. Defects in this gene have been associated with dehydrated hereditary stomatocytosis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Most mice homozygous for a gene trapped allele die at midgestation, exhibiting embryonic growth retardation, pericardial effusion, and vascular remodeling defects in the yolk sac and the embryo proper. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	A	T	10: 29,094,269 (GRCm39)	I52F	probably benign	Het
Abcc3	A	T	11: 94,250,072 (GRCm39)	L1017Q	probably damaging	Het
Antxr2	T	C	5: 98,096,186 (GRCm39)	D366G	possibly damaging	Het
Astn2	C	T	4: 65,831,978 (GRCm39)	V563I	probably benign	Het
Atrn	C	A	2: 130,803,536 (GRCm39)	D575E	probably damaging	Het
Baz1a	C	T	12: 54,946,882 (GRCm39)	D1228N	probably benign	Het
Canx	A	G	11: 50,195,301 (GRCm39)	S256P	probably benign	Het
Ccnt2	T	A	1: 127,729,925 (GRCm39)	D267E	probably damaging	Het
Cd209c	G	T	8: 3,995,905 (GRCm39)	R2S	probably benign	Het
Cyfip2	T	C	11: 46,087,135 (GRCm39)	T1252A	probably benign	Het
Dchs2	A	G	3: 83,261,301 (GRCm39)	Y2523C	probably benign	Het
Dmxl2	G	A	9: 54,323,892 (GRCm39)	P990L	probably benign	Het
Dnajc9	T	C	14: 20,438,279 (GRCm39)	I108V	probably benign	Het
Eif2d	T	C	1: 131,092,948 (GRCm39)		probably null	Het
Ephb2	T	C	4: 136,384,768 (GRCm39)	D881G	probably damaging	Het
Esr1	A	G	10: 4,951,215 (GRCm39)	N531S	probably benign	Het
Fbxo2	G	A	4: 148,248,883 (GRCm39)	R125H	probably damaging	Het
Foxred1	C	T	9: 35,117,300 (GRCm39)	S277N	possibly damaging	Het
Gemin5	T	C	11: 58,041,418 (GRCm39)	E518G	probably damaging	Het
Gm17655	A	G	5: 110,194,226 (GRCm39)	Y519H	probably benign	Het
Igkv4-57-1	A	T	6: 69,521,493 (GRCm39)	W70R	probably damaging	Het
Krtap4-13	A	G	11: 99,700,180 (GRCm39)	S160P	unknown	Het
Map3k3	A	G	11: 106,033,361 (GRCm39)	I205V	possibly damaging	Het
Map3k4	A	C	17: 12,490,523 (GRCm39)	F303V	probably benign	Het
Mpdz	T	C	4: 81,304,504 (GRCm39)	Q132R	probably damaging	Het
Myo10	T	A	15: 25,801,227 (GRCm39)	V1472E	probably damaging	Het
Nckap1	G	A	2: 80,401,568 (GRCm39)	Q39*	probably null	Het
Nog	A	G	11: 89,192,396 (GRCm39)	S151P	probably damaging	Het
Obox6	G	A	7: 15,568,831 (GRCm39)	S15F	probably benign	Het
Odf2	A	G	2: 29,813,594 (GRCm39)	H647R	possibly damaging	Het
Or6c74	A	G	10: 129,869,500 (GRCm39)	R2G	probably benign	Het
Pcdhga11	T	C	18: 37,890,398 (GRCm39)	S469P	possibly damaging	Het
Pcnx4	T	C	12: 72,603,039 (GRCm39)	Y434H	probably damaging	Het
Pfpl	G	C	19: 12,406,297 (GRCm39)	E183Q	probably damaging	Het
Pglyrp3	A	G	3: 91,938,695 (GRCm39)	K290R	possibly damaging	Het
Phactr3	G	A	2: 177,898,043 (GRCm39)	E86K	probably damaging	Het
Pigg	A	T	5: 108,495,767 (GRCm39)	I935F	possibly damaging	Het
Pofut2	T	C	10: 77,102,759 (GRCm39)	S282P	possibly damaging	Het
Ppfia1	A	G	7: 144,071,402 (GRCm39)	S337P	probably benign	Het
Sdr16c5	A	T	4: 4,005,595 (GRCm39)	D246E	probably benign	Het
Sgsm1	T	A	5: 113,428,207 (GRCm39)	H327L	possibly damaging	Het
Slc39a4	A	G	15: 76,500,211 (GRCm39)	I113T	possibly damaging	Het
Slc5a7	A	G	17: 54,603,985 (GRCm39)		probably null	Het
Snx11	A	G	11: 96,661,925 (GRCm39)	S86P	probably benign	Het
Srm	T	A	4: 148,676,245 (GRCm39)		probably null	Het
Tas2r126	T	C	6: 42,412,082 (GRCm39)	I205T	possibly damaging	Het
Tek	T	G	4: 94,692,539 (GRCm39)	W216G	possibly damaging	Het
Tenm3	A	T	8: 48,753,849 (GRCm39)	S851R	probably benign	Het
Tnip2	A	G	5: 34,654,212 (GRCm39)	V288A	probably benign	Het
Tpx2	T	A	2: 152,733,476 (GRCm39)		probably null	Het
Trim33	C	A	3: 103,261,146 (GRCm39)	T1115K	possibly damaging	Het
Tspan13	T	A	12: 36,074,017 (GRCm39)	I40F	probably damaging	Het
Ube2v2	T	C	16: 15,394,899 (GRCm39)	I91V	probably benign	Het
Vmn1r22	A	T	6: 57,877,631 (GRCm39)	F115L	probably benign	Het
Vmn2r7	G	A	3: 64,598,407 (GRCm39)	P717S	probably damaging	Het
Zan	T	C	5: 137,387,324 (GRCm39)	T4910A	unknown	Het
Zfp599	T	A	9: 22,160,741 (GRCm39)	T475S	probably damaging	Het
Zfp638	T	A	6: 83,923,301 (GRCm39)	F700I	probably damaging	Het
Zfp985	A	C	4: 147,667,618 (GRCm39)	K162T	possibly damaging	Het

Other mutations in Piezo1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00896:Piezo1	APN	8	123,224,609 (GRCm39)	missense	possibly damaging	0.91
IGL01094:Piezo1	APN	8	123,208,877 (GRCm39)	missense	probably damaging	0.99
IGL01321:Piezo1	APN	8	123,214,339 (GRCm39)	missense	probably damaging	0.99
IGL01695:Piezo1	APN	8	123,222,248 (GRCm39)	missense	possibly damaging	0.81
IGL01762:Piezo1	APN	8	123,214,668 (GRCm39)	nonsense	probably null
IGL01922:Piezo1	APN	8	123,219,431 (GRCm39)	missense	probably benign	0.41
IGL01953:Piezo1	APN	8	123,217,923 (GRCm39)	missense	probably damaging	1.00
IGL01997:Piezo1	APN	8	123,215,070 (GRCm39)	splice site	probably benign
IGL02381:Piezo1	APN	8	123,225,283 (GRCm39)	missense	probably benign	0.28
IGL02398:Piezo1	APN	8	123,213,302 (GRCm39)	missense	probably benign	0.21
IGL02562:Piezo1	APN	8	123,223,502 (GRCm39)	missense	probably benign	0.11
IGL02572:Piezo1	APN	8	123,212,044 (GRCm39)	missense	probably benign	0.28
IGL02691:Piezo1	APN	8	123,228,688 (GRCm39)	missense	possibly damaging	0.58
IGL02726:Piezo1	APN	8	123,213,894 (GRCm39)	missense	probably damaging	0.99
IGL02814:Piezo1	APN	8	123,224,954 (GRCm39)	missense	probably damaging	1.00
IGL02931:Piezo1	APN	8	123,210,258 (GRCm39)	missense	probably damaging	1.00
IGL03145:Piezo1	APN	8	123,209,660 (GRCm39)	missense	probably benign	0.14
FR4449:Piezo1	UTSW	8	123,222,308 (GRCm39)	missense	probably damaging	1.00
FR4548:Piezo1	UTSW	8	123,222,308 (GRCm39)	missense	probably damaging	1.00
FR4737:Piezo1	UTSW	8	123,222,308 (GRCm39)	missense	probably damaging	1.00
FR4976:Piezo1	UTSW	8	123,222,308 (GRCm39)	missense	probably damaging	1.00
LCD18:Piezo1	UTSW	8	123,222,308 (GRCm39)	missense	probably damaging	1.00
R0085:Piezo1	UTSW	8	123,228,354 (GRCm39)	missense	probably damaging	0.98
R0096:Piezo1	UTSW	8	123,212,109 (GRCm39)	unclassified	probably benign
R0970:Piezo1	UTSW	8	123,213,549 (GRCm39)	missense	possibly damaging	0.94
R1364:Piezo1	UTSW	8	123,225,310 (GRCm39)	missense	possibly damaging	0.61
R1460:Piezo1	UTSW	8	123,228,890 (GRCm39)	missense	possibly damaging	0.86
R1485:Piezo1	UTSW	8	123,208,788 (GRCm39)	missense	probably damaging	1.00
R1538:Piezo1	UTSW	8	123,218,142 (GRCm39)	missense	probably damaging	1.00
R1655:Piezo1	UTSW	8	123,223,561 (GRCm39)	missense	probably benign	0.09
R1700:Piezo1	UTSW	8	123,214,241 (GRCm39)	missense	probably damaging	1.00
R1860:Piezo1	UTSW	8	123,222,489 (GRCm39)	missense	possibly damaging	0.90
R1861:Piezo1	UTSW	8	123,222,489 (GRCm39)	missense	possibly damaging	0.90
R1899:Piezo1	UTSW	8	123,216,305 (GRCm39)	missense	probably damaging	1.00
R1899:Piezo1	UTSW	8	123,209,384 (GRCm39)	unclassified	probably benign
R1900:Piezo1	UTSW	8	123,209,384 (GRCm39)	unclassified	probably benign
R2018:Piezo1	UTSW	8	123,209,451 (GRCm39)	missense	probably benign	0.43
R2019:Piezo1	UTSW	8	123,209,451 (GRCm39)	missense	probably benign	0.43
R2219:Piezo1	UTSW	8	123,218,227 (GRCm39)	missense	probably benign	0.01
R2331:Piezo1	UTSW	8	123,214,005 (GRCm39)	splice site	probably null
R3016:Piezo1	UTSW	8	123,232,766 (GRCm39)	critical splice donor site	probably null
R3699:Piezo1	UTSW	8	123,221,642 (GRCm39)	missense	probably damaging	1.00
R3700:Piezo1	UTSW	8	123,221,642 (GRCm39)	missense	probably damaging	1.00
R3746:Piezo1	UTSW	8	123,219,377 (GRCm39)	missense	probably damaging	1.00
R3905:Piezo1	UTSW	8	123,208,882 (GRCm39)	missense	probably damaging	1.00
R4093:Piezo1	UTSW	8	123,227,899 (GRCm39)	critical splice donor site	probably null
R4296:Piezo1	UTSW	8	123,217,866 (GRCm39)	missense	probably damaging	1.00
R4396:Piezo1	UTSW	8	123,225,413 (GRCm39)	missense	probably damaging	0.98
R4467:Piezo1	UTSW	8	123,213,135 (GRCm39)	missense	probably benign	0.17
R4614:Piezo1	UTSW	8	123,213,150 (GRCm39)	missense	probably benign	0.25
R4642:Piezo1	UTSW	8	123,222,193 (GRCm39)	missense	probably damaging	1.00
R4688:Piezo1	UTSW	8	123,215,278 (GRCm39)	missense	probably damaging	1.00
R4734:Piezo1	UTSW	8	123,224,945 (GRCm39)	missense	probably damaging	1.00
R4749:Piezo1	UTSW	8	123,224,945 (GRCm39)	missense	probably damaging	1.00
R4749:Piezo1	UTSW	8	123,213,678 (GRCm39)	missense	possibly damaging	0.48
R4865:Piezo1	UTSW	8	123,213,660 (GRCm39)	missense	probably damaging	1.00
R4869:Piezo1	UTSW	8	123,214,284 (GRCm39)	missense	probably benign
R4962:Piezo1	UTSW	8	123,213,220 (GRCm39)	missense	probably benign	0.41
R5026:Piezo1	UTSW	8	123,213,557 (GRCm39)	missense	probably benign	0.11
R5418:Piezo1	UTSW	8	123,213,519 (GRCm39)	missense	probably damaging	1.00
R5625:Piezo1	UTSW	8	123,209,699 (GRCm39)	missense	probably benign	0.01
R5759:Piezo1	UTSW	8	123,234,394 (GRCm39)	missense	probably damaging	0.98
R5864:Piezo1	UTSW	8	123,213,112 (GRCm39)	missense	possibly damaging	0.75
R5898:Piezo1	UTSW	8	123,214,682 (GRCm39)	missense	probably benign	0.00
R5948:Piezo1	UTSW	8	123,210,086 (GRCm39)	missense	probably benign	0.01
R6052:Piezo1	UTSW	8	123,233,008 (GRCm39)	missense	probably damaging	1.00
R6086:Piezo1	UTSW	8	123,228,396 (GRCm39)	missense	possibly damaging	0.73
R6216:Piezo1	UTSW	8	123,215,869 (GRCm39)	missense	probably benign	0.05
R6271:Piezo1	UTSW	8	123,221,671 (GRCm39)	missense	probably damaging	1.00
R6549:Piezo1	UTSW	8	123,227,002 (GRCm39)	missense
R6723:Piezo1	UTSW	8	123,234,366 (GRCm39)	missense	probably benign	0.15
R6871:Piezo1	UTSW	8	123,211,766 (GRCm39)	splice site	probably null
R6919:Piezo1	UTSW	8	123,217,020 (GRCm39)	missense	probably damaging	1.00
R7085:Piezo1	UTSW	8	123,217,633 (GRCm39)	missense
R7105:Piezo1	UTSW	8	123,208,857 (GRCm39)	missense	unknown
R7267:Piezo1	UTSW	8	123,224,268 (GRCm39)	missense
R7337:Piezo1	UTSW	8	123,212,463 (GRCm39)	missense
R7381:Piezo1	UTSW	8	123,228,397 (GRCm39)	missense
R7480:Piezo1	UTSW	8	123,225,234 (GRCm39)	nonsense	probably null
R7515:Piezo1	UTSW	8	123,212,035 (GRCm39)	missense
R7571:Piezo1	UTSW	8	123,225,157 (GRCm39)	missense
R7601:Piezo1	UTSW	8	123,210,220 (GRCm39)	splice site	probably null
R7827:Piezo1	UTSW	8	123,209,659 (GRCm39)	missense	probably damaging	0.96
R7923:Piezo1	UTSW	8	123,223,183 (GRCm39)	missense
R7975:Piezo1	UTSW	8	123,222,504 (GRCm39)	missense
R8071:Piezo1	UTSW	8	123,213,750 (GRCm39)	missense	probably null
R8231:Piezo1	UTSW	8	123,232,836 (GRCm39)	missense
R8270:Piezo1	UTSW	8	123,228,298 (GRCm39)	missense
R8784:Piezo1	UTSW	8	123,223,328 (GRCm39)	splice site	probably benign
R8788:Piezo1	UTSW	8	123,228,533 (GRCm39)	missense
R8829:Piezo1	UTSW	8	123,217,753 (GRCm39)	missense
R8890:Piezo1	UTSW	8	123,216,330 (GRCm39)	missense
R8950:Piezo1	UTSW	8	123,208,729 (GRCm39)	missense	probably benign	0.01
R8994:Piezo1	UTSW	8	123,209,829 (GRCm39)	missense	unknown
R9036:Piezo1	UTSW	8	123,215,090 (GRCm39)	missense
R9145:Piezo1	UTSW	8	123,208,753 (GRCm39)	missense	unknown
R9146:Piezo1	UTSW	8	123,227,002 (GRCm39)	missense
R9251:Piezo1	UTSW	8	123,219,354 (GRCm39)	missense
R9307:Piezo1	UTSW	8	123,213,832 (GRCm39)	missense
R9375:Piezo1	UTSW	8	123,228,604 (GRCm39)	missense
R9424:Piezo1	UTSW	8	123,218,079 (GRCm39)	missense
R9578:Piezo1	UTSW	8	123,224,214 (GRCm39)	missense
R9775:Piezo1	UTSW	8	123,208,927 (GRCm39)	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTGACGTAGATGCCGGTGAC -3'
(R):5'- GTGTCTCTGAGGCTTTCACG -3'

Sequencing Primer
(F):5'- TAGATGCCGGTGACCAGCTC -3'
(R):5'- ACGTACGTCCGTGAATCTGTGAC -3'

Posted On

2022-10-06