Incidental Mutation 'R9723:Cyp2b9'
ID 730921
Institutional Source Beutler Lab
Gene Symbol Cyp2b9
Ensembl Gene ENSMUSG00000040660
Gene Name cytochrome P450, family 2, subfamily b, polypeptide 9
Synonyms 16\alphaoh-a, phenobarbitol inducible, type a, Cyp2b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R9723 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 26173411-26210661 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 26210171 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 455 (Q455*)
Ref Sequence ENSEMBL: ENSMUSP00000080846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082214]
AlphaFold P12790
Predicted Effect probably null
Transcript: ENSMUST00000082214
AA Change: Q455*
SMART Domains Protein: ENSMUSP00000080846
Gene: ENSMUSG00000040660
AA Change: Q455*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:p450 31 488 1.7e-146 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,228,355 H84R probably damaging Het
Abcb6 G A 1: 75,179,722 R133W probably benign Het
Abcc3 T A 11: 94,359,899 T877S probably benign Het
Alb A T 5: 90,464,103 K130N probably damaging Het
Alkbh8 G A 9: 3,385,283 S560N probably benign Het
Angel2 T G 1: 190,939,145 L234R probably damaging Het
Catip C T 1: 74,364,586 T154I probably benign Het
Ccdc163 C T 4: 116,712,398 Q102* probably null Het
Cep250 A G 2: 155,981,417 E997G probably benign Het
Ces2f T C 8: 104,950,831 I183T possibly damaging Het
Commd8 A G 5: 72,160,966 V158A possibly damaging Het
D5Ertd579e G T 5: 36,614,940 H704N probably damaging Het
Dnah1 T C 14: 31,265,989 T3491A probably damaging Het
Dnaic1 T G 4: 41,603,302 F195C possibly damaging Het
Dock7 A G 4: 99,020,033 V620A Het
Dock7 A T 4: 99,072,423 D289E Het
Dpys T A 15: 39,828,113 E271V probably damaging Het
Elovl3 T C 19: 46,134,716 Y244H probably damaging Het
Enam G A 5: 88,504,382 G1250E probably damaging Het
Espl1 C T 15: 102,320,735 T1774M probably benign Het
Fasl T C 1: 161,787,966 K107R probably benign Het
Fbn1 A T 2: 125,360,199 C1251* probably null Het
Fn1 G T 1: 71,624,210 Q1040K possibly damaging Het
Frem3 C T 8: 80,614,723 S1215L probably benign Het
G3bp2 A T 5: 92,066,529 D135E possibly damaging Het
Gabpb1 C T 2: 126,646,728 V240I probably benign Het
Galnt12 C G 4: 47,119,541 Y452* probably null Het
Ggta1 G T 2: 35,413,406 D91E probably benign Het
Gm12258 C T 11: 58,859,622 P541L unknown Het
Gm12789 T A 4: 101,988,886 W115R possibly damaging Het
Gm8126 T C 14: 43,261,684 probably null Het
Gpr179 A T 11: 97,334,720 L2203H possibly damaging Het
Hapln3 A T 7: 79,121,988 V51E possibly damaging Het
Hist1h1t A G 13: 23,695,923 K20E probably damaging Het
Ifit1 A G 19: 34,648,857 *464W probably null Het
Il1r1 A C 1: 40,293,561 I137L probably benign Het
Il1rap T A 16: 26,624,157 M1K probably null Het
Lgi2 A G 5: 52,538,501 L372P probably damaging Het
Lrrc46 A G 11: 97,034,947 S230P possibly damaging Het
Ltbr G A 6: 125,307,385 R365W probably damaging Het
Mapk8ip3 C A 17: 24,913,611 W339L possibly damaging Het
Msln A T 17: 25,750,034 M459K possibly damaging Het
Msr1 A G 8: 39,589,316 V406A possibly damaging Het
Ndst2 G T 14: 20,725,444 D659E probably benign Het
Npat T A 9: 53,562,446 S513T probably benign Het
Npat T G 9: 53,570,561 L1190V probably damaging Het
Npc1 A G 18: 12,210,592 I448T probably benign Het
Omd T C 13: 49,590,362 F296S probably damaging Het
Oprm1 A G 10: 6,838,514 N423S possibly damaging Het
Oxtr G A 6: 112,489,343 T152I probably benign Het
Pak2 A T 16: 32,033,832 V297E probably damaging Het
Pcnx4 T C 12: 72,556,265 Y434H probably damaging Het
Pet100 G A 8: 3,622,374 M20I probably damaging Het
Pfpl G C 19: 12,428,933 E183Q probably damaging Het
Plekhn1 A G 4: 156,222,418 S505P probably benign Het
Plin5 G A 17: 56,116,290 A90V probably damaging Het
Poc5 A G 13: 96,414,518 T526A probably benign Het
Pramel7 C T 2: 87,489,675 V425I possibly damaging Het
Rad51d A T 11: 82,890,336 probably null Het
Rbp3 T C 14: 33,955,517 M474T possibly damaging Het
Rcan3 A G 4: 135,425,369 S14P probably benign Het
Rps6ka4 A T 19: 6,839,295 V140E probably damaging Het
Rsbn1l G A 5: 20,896,466 S692L possibly damaging Het
Sgk1 A T 10: 21,996,340 I272F probably damaging Het
Skor1 A G 9: 63,146,432 V85A probably damaging Het
Slc12a1 A T 2: 125,217,907 D909V probably damaging Het
Slc25a18 C A 6: 120,793,528 A283E probably benign Het
Slc41a1 T C 1: 131,844,365 L411P possibly damaging Het
Spata13 T C 14: 60,691,049 S19P probably damaging Het
Stab1 T A 14: 31,163,891 H42L probably benign Het
Stag3 T A 5: 138,299,841 D698E probably benign Het
Syngap1 G A 17: 26,970,536 R1305H possibly damaging Het
Tek T G 4: 94,804,302 W216G possibly damaging Het
Trappc9 A G 15: 72,590,114 Y1101H possibly damaging Het
Ttn A G 2: 76,771,585 Y10251H probably damaging Het
Uhrf1 A G 17: 56,318,061 K535E probably damaging Het
Usp14 G T 18: 10,009,993 Q185K probably damaging Het
Usp32 A T 11: 85,044,710 Y413* probably null Het
Uvssa G A 5: 33,390,038 probably null Het
Vmn1r177 A T 7: 23,866,349 L34Q probably damaging Het
Wdr41 T C 13: 95,015,163 L277P probably damaging Het
Zc2hc1b T A 10: 13,168,753 L55F probably damaging Het
Zfp345 A C 2: 150,472,269 Y449* probably null Het
Other mutations in Cyp2b9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cyp2b9 APN 7 26198505 missense probably damaging 0.99
IGL01133:Cyp2b9 APN 7 26210235 missense probably damaging 1.00
IGL01331:Cyp2b9 APN 7 26187715 missense probably damaging 0.99
IGL02281:Cyp2b9 APN 7 26201104 missense probably damaging 0.99
IGL02502:Cyp2b9 APN 7 26187814 critical splice donor site probably null
IGL02713:Cyp2b9 APN 7 26173520 missense probably benign 0.12
IGL03032:Cyp2b9 APN 7 26198600 splice site probably benign
IGL03307:Cyp2b9 APN 7 26199051 missense probably benign 0.00
R0010:Cyp2b9 UTSW 7 26186753 splice site probably benign
R0025:Cyp2b9 UTSW 7 26200813 missense probably benign 0.09
R0040:Cyp2b9 UTSW 7 26173474 missense possibly damaging 0.68
R0184:Cyp2b9 UTSW 7 26187007 nonsense probably null
R0370:Cyp2b9 UTSW 7 26210106 missense probably damaging 1.00
R1595:Cyp2b9 UTSW 7 26200907 missense possibly damaging 0.72
R1751:Cyp2b9 UTSW 7 26186675 missense probably benign 0.05
R1835:Cyp2b9 UTSW 7 26200783 missense probably benign
R1879:Cyp2b9 UTSW 7 26198569 missense probably damaging 0.99
R2256:Cyp2b9 UTSW 7 26173605 critical splice donor site probably null
R2257:Cyp2b9 UTSW 7 26173605 critical splice donor site probably null
R2418:Cyp2b9 UTSW 7 26186707 missense probably benign 0.00
R3420:Cyp2b9 UTSW 7 26210103 missense probably damaging 1.00
R4088:Cyp2b9 UTSW 7 26173456 missense probably damaging 0.99
R4412:Cyp2b9 UTSW 7 26198443 missense probably damaging 1.00
R4495:Cyp2b9 UTSW 7 26200755 missense probably benign 0.00
R4615:Cyp2b9 UTSW 7 26201125 missense probably damaging 1.00
R5375:Cyp2b9 UTSW 7 26187742 missense probably damaging 1.00
R5426:Cyp2b9 UTSW 7 26187655 missense probably benign
R5862:Cyp2b9 UTSW 7 26187807 missense probably benign 0.01
R6237:Cyp2b9 UTSW 7 26173574 missense probably benign 0.02
R6445:Cyp2b9 UTSW 7 26186987 missense probably benign 0.13
R6992:Cyp2b9 UTSW 7 26201139 missense probably benign 0.00
R7515:Cyp2b9 UTSW 7 26199171 missense probably damaging 1.00
R7654:Cyp2b9 UTSW 7 26186942 missense possibly damaging 0.72
R7816:Cyp2b9 UTSW 7 26201092 missense probably benign 0.01
R7850:Cyp2b9 UTSW 7 26186686 nonsense probably null
R8734:Cyp2b9 UTSW 7 26198610 intron probably benign
R8790:Cyp2b9 UTSW 7 26198742 intron probably benign
R8839:Cyp2b9 UTSW 7 26200760 missense probably damaging 0.96
R9209:Cyp2b9 UTSW 7 26173579 missense possibly damaging 0.52
R9787:Cyp2b9 UTSW 7 26200834 missense probably benign 0.04
Z1177:Cyp2b9 UTSW 7 26201163 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGTGCATTGGACAGGGATGTC -3'
(R):5'- TTGGAGCTTTGGAGAACAACAG -3'

Sequencing Primer
(F):5'- TGCATTGGACAGGGATGTCTAAATG -3'
(R):5'- TGTGAGCAGCTACCAATGGC -3'
Posted On 2022-10-06