Incidental Mutation 'R9723:Usp32'
ID 730936
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9723 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 85044710 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 413 (Y413*)
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075] [ENSMUST00000172515]
AlphaFold F8VPZ3
Predicted Effect probably null
Transcript: ENSMUST00000108075
AA Change: Y413*
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804
AA Change: Y413*

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172515
SMART Domains Protein: ENSMUSP00000133781
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Blast:DUSP 1 52 7e-30 BLAST
low complexity region 53 65 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174602
SMART Domains Protein: ENSMUSP00000134476
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:DUSP 1 65 6.5e-17 PFAM
Pfam:Ubiquitin_3 122 216 8e-10 PFAM
Pfam:UCH 238 257 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T C 2: 111,228,355 H84R probably damaging Het
Abcb6 G A 1: 75,179,722 R133W probably benign Het
Abcc3 T A 11: 94,359,899 T877S probably benign Het
Alb A T 5: 90,464,103 K130N probably damaging Het
Alkbh8 G A 9: 3,385,283 S560N probably benign Het
Angel2 T G 1: 190,939,145 L234R probably damaging Het
Catip C T 1: 74,364,586 T154I probably benign Het
Ccdc163 C T 4: 116,712,398 Q102* probably null Het
Cep250 A G 2: 155,981,417 E997G probably benign Het
Ces2f T C 8: 104,950,831 I183T possibly damaging Het
Commd8 A G 5: 72,160,966 V158A possibly damaging Het
Cyp2b9 C T 7: 26,210,171 Q455* probably null Het
D5Ertd579e G T 5: 36,614,940 H704N probably damaging Het
Dnah1 T C 14: 31,265,989 T3491A probably damaging Het
Dnaic1 T G 4: 41,603,302 F195C possibly damaging Het
Dock7 A G 4: 99,020,033 V620A Het
Dock7 A T 4: 99,072,423 D289E Het
Dpys T A 15: 39,828,113 E271V probably damaging Het
Elovl3 T C 19: 46,134,716 Y244H probably damaging Het
Enam G A 5: 88,504,382 G1250E probably damaging Het
Espl1 C T 15: 102,320,735 T1774M probably benign Het
Fasl T C 1: 161,787,966 K107R probably benign Het
Fbn1 A T 2: 125,360,199 C1251* probably null Het
Fn1 G T 1: 71,624,210 Q1040K possibly damaging Het
Frem3 C T 8: 80,614,723 S1215L probably benign Het
G3bp2 A T 5: 92,066,529 D135E possibly damaging Het
Gabpb1 C T 2: 126,646,728 V240I probably benign Het
Galnt12 C G 4: 47,119,541 Y452* probably null Het
Ggta1 G T 2: 35,413,406 D91E probably benign Het
Gm12258 C T 11: 58,859,622 P541L unknown Het
Gm12789 T A 4: 101,988,886 W115R possibly damaging Het
Gm8126 T C 14: 43,261,684 probably null Het
Gpr179 A T 11: 97,334,720 L2203H possibly damaging Het
Hapln3 A T 7: 79,121,988 V51E possibly damaging Het
Hist1h1t A G 13: 23,695,923 K20E probably damaging Het
Ifit1 A G 19: 34,648,857 *464W probably null Het
Il1r1 A C 1: 40,293,561 I137L probably benign Het
Il1rap T A 16: 26,624,157 M1K probably null Het
Lgi2 A G 5: 52,538,501 L372P probably damaging Het
Lrrc46 A G 11: 97,034,947 S230P possibly damaging Het
Ltbr G A 6: 125,307,385 R365W probably damaging Het
Mapk8ip3 C A 17: 24,913,611 W339L possibly damaging Het
Msln A T 17: 25,750,034 M459K possibly damaging Het
Msr1 A G 8: 39,589,316 V406A possibly damaging Het
Ndst2 G T 14: 20,725,444 D659E probably benign Het
Npat T A 9: 53,562,446 S513T probably benign Het
Npat T G 9: 53,570,561 L1190V probably damaging Het
Npc1 A G 18: 12,210,592 I448T probably benign Het
Omd T C 13: 49,590,362 F296S probably damaging Het
Oprm1 A G 10: 6,838,514 N423S possibly damaging Het
Oxtr G A 6: 112,489,343 T152I probably benign Het
Pak2 A T 16: 32,033,832 V297E probably damaging Het
Pcnx4 T C 12: 72,556,265 Y434H probably damaging Het
Pet100 G A 8: 3,622,374 M20I probably damaging Het
Pfpl G C 19: 12,428,933 E183Q probably damaging Het
Plekhn1 A G 4: 156,222,418 S505P probably benign Het
Plin5 G A 17: 56,116,290 A90V probably damaging Het
Poc5 A G 13: 96,414,518 T526A probably benign Het
Pramel7 C T 2: 87,489,675 V425I possibly damaging Het
Rad51d A T 11: 82,890,336 probably null Het
Rbp3 T C 14: 33,955,517 M474T possibly damaging Het
Rcan3 A G 4: 135,425,369 S14P probably benign Het
Rps6ka4 A T 19: 6,839,295 V140E probably damaging Het
Rsbn1l G A 5: 20,896,466 S692L possibly damaging Het
Sgk1 A T 10: 21,996,340 I272F probably damaging Het
Skor1 A G 9: 63,146,432 V85A probably damaging Het
Slc12a1 A T 2: 125,217,907 D909V probably damaging Het
Slc25a18 C A 6: 120,793,528 A283E probably benign Het
Slc41a1 T C 1: 131,844,365 L411P possibly damaging Het
Spata13 T C 14: 60,691,049 S19P probably damaging Het
Stab1 T A 14: 31,163,891 H42L probably benign Het
Stag3 T A 5: 138,299,841 D698E probably benign Het
Syngap1 G A 17: 26,970,536 R1305H possibly damaging Het
Tek T G 4: 94,804,302 W216G possibly damaging Het
Trappc9 A G 15: 72,590,114 Y1101H possibly damaging Het
Ttn A G 2: 76,771,585 Y10251H probably damaging Het
Uhrf1 A G 17: 56,318,061 K535E probably damaging Het
Usp14 G T 18: 10,009,993 Q185K probably damaging Het
Uvssa G A 5: 33,390,038 probably null Het
Vmn1r177 A T 7: 23,866,349 L34Q probably damaging Het
Wdr41 T C 13: 95,015,163 L277P probably damaging Het
Zc2hc1b T A 10: 13,168,753 L55F probably damaging Het
Zfp345 A C 2: 150,472,269 Y449* probably null Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7973:Usp32 UTSW 11 85022808 missense probably damaging 0.99
R7989:Usp32 UTSW 11 85034300 missense
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9002:Usp32 UTSW 11 85053951 missense probably damaging 0.96
R9145:Usp32 UTSW 11 85022292 missense probably damaging 1.00
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9296:Usp32 UTSW 11 85017652 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9417:Usp32 UTSW 11 84994543 missense probably damaging 1.00
R9514:Usp32 UTSW 11 85022734 missense probably damaging 0.99
R9652:Usp32 UTSW 11 85030491 missense probably damaging 0.97
R9757:Usp32 UTSW 11 85077329 nonsense probably null
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTAGAAATGCATACACTGAGCC -3'
(R):5'- ACTAATTGAAGTGGTGACAGTCTC -3'

Sequencing Primer
(F):5'- GAAATGCATACACTGAGCCTGTTC -3'
(R):5'- GGACGTTTCTAGTGATAAACTGCAG -3'
Posted On 2022-10-06