Incidental Mutation 'R9725:Naip5'
ID 731001
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene Name NLR family, apoptosis inhibitory protein 5
Synonyms Birc1e, Naip-rs3, Lgn1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R9725 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 100348247-100382831 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100358784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 817 (D817E)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
AlphaFold Q9R016
Predicted Effect possibly damaging
Transcript: ENSMUST00000049789
AA Change: D817E

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: D817E

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T G 16: 14,290,797 (GRCm39) I1469S possibly damaging Het
Aff1 A T 5: 103,994,931 (GRCm39) D1043V probably damaging Het
Ahnak T A 19: 8,991,607 (GRCm39) I4297N probably damaging Het
Ahnak A G 19: 8,981,533 (GRCm39) N939S probably benign Het
Camk2b T C 11: 5,922,634 (GRCm39) N465S possibly damaging Het
Carns1 A G 19: 4,216,548 (GRCm39) S545P probably damaging Het
Cdh23 T A 10: 60,432,561 (GRCm39) Q121L probably benign Het
Cfap221 G T 1: 119,862,352 (GRCm39) Q577K probably benign Het
Dlg1 T G 16: 31,665,683 (GRCm39) L680R probably benign Het
Fahd2a T C 2: 127,278,304 (GRCm39) E301G probably benign Het
Fn3k T A 11: 121,341,191 (GRCm39) L282H probably damaging Het
Fubp1 T A 3: 151,927,823 (GRCm39) I424N probably damaging Het
Gkn1 A G 6: 87,323,289 (GRCm39) S175P probably damaging Het
Gm12695 A G 4: 96,616,466 (GRCm39) S456P probably damaging Het
Kcna5 T C 6: 126,511,844 (GRCm39) T95A probably benign Het
Kcnj13 G T 1: 87,314,737 (GRCm39) T83K probably benign Het
Kif19b G A 5: 140,460,651 (GRCm39) R439H probably benign Het
Klra10 C T 6: 130,252,849 (GRCm39) G142R probably benign Het
Krt14 T C 11: 100,097,902 (GRCm39) N127S probably damaging Het
Layn T C 9: 50,968,775 (GRCm39) M323V probably benign Het
Lrrd1 A G 5: 3,901,147 (GRCm39) D484G probably benign Het
Lrrtm2 A G 18: 35,345,788 (GRCm39) C505R probably damaging Het
Ms4a14 A T 19: 11,280,729 (GRCm39) S610T probably benign Het
Myo5b A G 18: 74,856,841 (GRCm39) N1282S probably benign Het
Ndufs2 A G 1: 171,074,629 (GRCm39) L10P possibly damaging Het
Nxn T C 11: 76,169,362 (GRCm39) D139G probably damaging Het
Or3a1b A G 11: 74,012,612 (GRCm39) T166A probably benign Het
Or5b105 G A 19: 13,080,272 (GRCm39) T132I possibly damaging Het
Or6aa1 A C 7: 86,043,973 (GRCm39) H244Q probably damaging Het
Pcdhb22 G T 18: 37,652,794 (GRCm39) V164F probably damaging Het
Plch2 T C 4: 155,084,992 (GRCm39) T417A probably damaging Het
Prcp G T 7: 92,567,035 (GRCm39) probably null Het
Rasgrp2 A G 19: 6,454,694 (GRCm39) Y178C probably damaging Het
Rasgrp2 A G 19: 6,463,907 (GRCm39) N535S probably benign Het
Rgs20 G T 1: 4,980,793 (GRCm39) Y208* probably null Het
Slc39a10 A G 1: 46,849,223 (GRCm39) C798R probably damaging Het
Slco2b1 A G 7: 99,335,265 (GRCm39) S172P probably benign Het
Styk1 GTCTCTTCATGATT GT 6: 131,278,610 (GRCm39) probably benign Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,278,612 (GRCm39) probably benign Het
Tmc2 T A 2: 130,089,881 (GRCm39) I622N probably damaging Het
Trav16n A G 14: 53,588,559 (GRCm39) S5G probably benign Het
Tti1 C T 2: 157,849,304 (GRCm39) R645H probably benign Het
Ttll3 A G 6: 113,386,114 (GRCm39) D649G probably damaging Het
Vcam1 C T 3: 115,922,287 (GRCm39) V79I possibly damaging Het
Vmn1r211 T C 13: 23,036,506 (GRCm39) I54V probably benign Het
Vmn1r238 A G 18: 3,122,577 (GRCm39) F279S probably benign Het
Vps33a A T 5: 123,669,135 (GRCm39) W589R possibly damaging Het
Zic1 A G 9: 91,246,875 (GRCm39) S66P probably damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100,382,683 (GRCm39) nonsense probably null
IGL00493:Naip5 APN 13 100,367,279 (GRCm39) missense probably damaging 0.96
IGL01294:Naip5 APN 13 100,353,588 (GRCm39) missense probably damaging 0.99
IGL01405:Naip5 APN 13 100,358,453 (GRCm39) missense probably benign 0.11
IGL01568:Naip5 APN 13 100,353,609 (GRCm39) missense probably benign 0.26
IGL01804:Naip5 APN 13 100,358,092 (GRCm39) missense probably damaging 1.00
IGL02012:Naip5 APN 13 100,359,847 (GRCm39) missense probably benign 0.01
IGL02183:Naip5 APN 13 100,358,150 (GRCm39) missense probably benign 0.41
IGL02449:Naip5 APN 13 100,358,683 (GRCm39) missense probably benign 0.34
IGL02815:Naip5 APN 13 100,359,239 (GRCm39) missense probably benign
IGL02992:Naip5 APN 13 100,359,536 (GRCm39) missense probably damaging 1.00
IGL03027:Naip5 APN 13 100,359,524 (GRCm39) missense probably benign 0.00
IGL03234:Naip5 APN 13 100,349,135 (GRCm39) missense probably damaging 1.00
inwood2 UTSW 13 100,359,522 (GRCm39) nonsense probably null
inwood3 UTSW 13 100,358,411 (GRCm39) nonsense probably null
Nuchal UTSW 13 100,351,171 (GRCm39) missense possibly damaging 0.82
PIT4131001:Naip5 UTSW 13 100,356,268 (GRCm39) missense probably benign 0.00
PIT4131001:Naip5 UTSW 13 100,356,247 (GRCm39) missense probably benign
R0001:Naip5 UTSW 13 100,359,622 (GRCm39) missense probably benign
R0001:Naip5 UTSW 13 100,351,158 (GRCm39) critical splice donor site probably null
R0462:Naip5 UTSW 13 100,358,240 (GRCm39) missense probably damaging 1.00
R0636:Naip5 UTSW 13 100,356,196 (GRCm39) missense probably benign
R0674:Naip5 UTSW 13 100,359,707 (GRCm39) missense probably benign 0.04
R0764:Naip5 UTSW 13 100,353,613 (GRCm39) missense probably benign 0.03
R0837:Naip5 UTSW 13 100,367,251 (GRCm39) missense probably benign
R1179:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R1302:Naip5 UTSW 13 100,358,099 (GRCm39) missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100,356,225 (GRCm39) missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100,358,714 (GRCm39) missense probably benign
R1638:Naip5 UTSW 13 100,349,177 (GRCm39) missense probably damaging 1.00
R1651:Naip5 UTSW 13 100,358,419 (GRCm39) missense probably benign 0.41
R1707:Naip5 UTSW 13 100,379,363 (GRCm39) missense probably damaging 1.00
R1835:Naip5 UTSW 13 100,359,726 (GRCm39) nonsense probably null
R1836:Naip5 UTSW 13 100,356,195 (GRCm39) missense probably benign 0.18
R1972:Naip5 UTSW 13 100,349,278 (GRCm39) missense probably damaging 0.98
R2080:Naip5 UTSW 13 100,358,041 (GRCm39) missense probably damaging 1.00
R2333:Naip5 UTSW 13 100,359,679 (GRCm39) missense probably damaging 1.00
R2348:Naip5 UTSW 13 100,356,246 (GRCm39) missense probably benign 0.01
R3055:Naip5 UTSW 13 100,358,386 (GRCm39) missense probably benign 0.23
R3401:Naip5 UTSW 13 100,358,411 (GRCm39) nonsense probably null
R3723:Naip5 UTSW 13 100,359,522 (GRCm39) nonsense probably null
R3775:Naip5 UTSW 13 100,359,902 (GRCm39) missense probably benign 0.00
R3775:Naip5 UTSW 13 100,359,883 (GRCm39) missense probably benign 0.00
R4019:Naip5 UTSW 13 100,359,883 (GRCm39) missense probably benign 0.00
R4019:Naip5 UTSW 13 100,359,902 (GRCm39) missense probably benign 0.00
R4020:Naip5 UTSW 13 100,359,902 (GRCm39) missense probably benign 0.00
R4020:Naip5 UTSW 13 100,359,883 (GRCm39) missense probably benign 0.00
R4074:Naip5 UTSW 13 100,382,572 (GRCm39) missense probably damaging 1.00
R4082:Naip5 UTSW 13 100,382,338 (GRCm39) missense probably damaging 1.00
R4105:Naip5 UTSW 13 100,356,247 (GRCm39) missense probably benign
R4227:Naip5 UTSW 13 100,349,276 (GRCm39) missense probably damaging 0.99
R4639:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4640:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4641:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4644:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4645:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4700:Naip5 UTSW 13 100,359,922 (GRCm39) missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100,358,378 (GRCm39) missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100,358,639 (GRCm39) missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100,356,189 (GRCm39) missense probably benign 0.32
R4816:Naip5 UTSW 13 100,356,195 (GRCm39) missense probably benign 0.01
R4816:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R4869:Naip5 UTSW 13 100,381,639 (GRCm39) missense probably damaging 1.00
R5162:Naip5 UTSW 13 100,359,914 (GRCm39) missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100,382,170 (GRCm39) missense probably benign 0.08
R5411:Naip5 UTSW 13 100,382,254 (GRCm39) missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100,367,170 (GRCm39) splice site probably null
R5760:Naip5 UTSW 13 100,379,346 (GRCm39) missense probably damaging 1.00
R5916:Naip5 UTSW 13 100,359,209 (GRCm39) missense probably benign 0.02
R6302:Naip5 UTSW 13 100,359,674 (GRCm39) missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100,359,674 (GRCm39) missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100,359,913 (GRCm39) missense probably benign 0.01
R6474:Naip5 UTSW 13 100,351,171 (GRCm39) missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100,358,102 (GRCm39) missense probably benign
R6544:Naip5 UTSW 13 100,359,652 (GRCm39) missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100,382,437 (GRCm39) missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100,359,922 (GRCm39) missense probably damaging 0.99
R7052:Naip5 UTSW 13 100,358,855 (GRCm39) missense probably benign 0.01
R7138:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R7141:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R7375:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7375:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7401:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7401:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7447:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7447:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7466:Naip5 UTSW 13 100,358,494 (GRCm39) nonsense probably null
R7491:Naip5 UTSW 13 100,353,579 (GRCm39) missense probably benign 0.18
R7559:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7559:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7562:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7562:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7588:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7588:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7589:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7589:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7590:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7590:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7742:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R7886:Naip5 UTSW 13 100,382,689 (GRCm39) missense probably benign 0.28
R7996:Naip5 UTSW 13 100,358,164 (GRCm39) missense probably damaging 1.00
R8026:Naip5 UTSW 13 100,382,406 (GRCm39) missense probably damaging 1.00
R8046:Naip5 UTSW 13 100,358,741 (GRCm39) missense probably benign
R8319:Naip5 UTSW 13 100,358,167 (GRCm39) missense probably benign 0.12
R8471:Naip5 UTSW 13 100,358,153 (GRCm39) missense probably damaging 0.99
R8480:Naip5 UTSW 13 100,358,743 (GRCm39) missense probably damaging 1.00
R8496:Naip5 UTSW 13 100,349,247 (GRCm39) missense probably benign 0.00
R8500:Naip5 UTSW 13 100,359,220 (GRCm39) missense probably damaging 0.98
R8712:Naip5 UTSW 13 100,359,604 (GRCm39) missense possibly damaging 0.61
R8780:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8781:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8788:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8817:Naip5 UTSW 13 100,349,207 (GRCm39) missense probably benign 0.01
R8833:Naip5 UTSW 13 100,359,442 (GRCm39) missense probably damaging 0.97
R8835:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8958:Naip5 UTSW 13 100,354,117 (GRCm39) nonsense probably null
R9031:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9032:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9074:Naip5 UTSW 13 100,358,264 (GRCm39) missense possibly damaging 0.92
R9098:Naip5 UTSW 13 100,366,127 (GRCm39) missense possibly damaging 0.67
R9204:Naip5 UTSW 13 100,359,008 (GRCm39) missense probably damaging 1.00
R9223:Naip5 UTSW 13 100,364,184 (GRCm39) missense probably benign 0.05
R9358:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9389:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9403:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9518:Naip5 UTSW 13 100,358,367 (GRCm39) missense probably benign
R9568:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9568:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9569:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9569:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9570:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9572:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9581:Naip5 UTSW 13 100,351,194 (GRCm39) missense probably benign 0.11
R9627:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9763:Naip5 UTSW 13 100,367,269 (GRCm39) missense probably damaging 0.99
R9764:Naip5 UTSW 13 100,367,269 (GRCm39) missense probably damaging 0.99
R9765:Naip5 UTSW 13 100,367,269 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCCTCAACAGTAACAGGC -3'
(R):5'- CTCCTGAGTTCAGATAGGCAG -3'

Sequencing Primer
(F):5'- AAAGCCAGTGTTTTTCCTCGAAGG -3'
(R):5'- CCTGAGTTCAGATAGGCAGGAAGAC -3'
Posted On 2022-10-06