Incidental Mutation 'R9726:0610030E20Rik'
ID 731037
Institutional Source Beutler Lab
Gene Symbol 0610030E20Rik
Ensembl Gene ENSMUSG00000058706
Gene Name RIKEN cDNA 0610030E20 gene
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R9726 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 72324300-72330131 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72325650 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 122 (V122A)
Ref Sequence ENSEMBL: ENSMUSP00000076957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070345] [ENSMUST00000077783]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000070345
SMART Domains Protein: ENSMUSP00000064515
Gene: ENSMUSG00000056305

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 48 73 N/A INTRINSIC
ZnF_C2H2 133 154 5.07e0 SMART
Pfam:UCH 223 551 3.9e-45 PFAM
Pfam:UCH_1 224 533 1.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000077783
AA Change: V122A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076957
Gene: ENSMUSG00000058706
AA Change: V122A

DomainStartEndE-ValueType
Pfam:UPF0561 1 126 4.4e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 T C 15: 72,998,919 (GRCm39) Y226C probably damaging Het
Akap9 A G 5: 4,053,757 (GRCm39) K1574R probably benign Het
Apob T C 12: 8,056,926 (GRCm39) Y1803H probably damaging Het
Atosb T C 4: 43,034,991 (GRCm39) D302G probably damaging Het
Bex6 A T 16: 32,005,243 (GRCm39) D17V probably damaging Het
Cd72 T G 4: 43,452,641 (GRCm39) probably null Het
Cdcp2 C A 4: 106,959,936 (GRCm39) S117Y probably damaging Het
Cenpx A G 11: 120,603,328 (GRCm39) L22P unknown Het
Cep135 A G 5: 76,741,151 (GRCm39) T76A probably benign Het
Cps1 A T 1: 67,195,395 (GRCm39) Q272L probably benign Het
Cul4a C T 8: 13,156,208 (GRCm39) P55S probably benign Het
Cyp2f2 C T 7: 26,821,411 (GRCm39) T108I probably damaging Het
Dapk1 T C 13: 60,898,948 (GRCm39) V806A probably benign Het
Dgki T C 6: 37,276,858 (GRCm39) H9R unknown Het
Dmxl2 A T 9: 54,322,996 (GRCm39) S1289T probably benign Het
Dock8 T A 19: 25,154,374 (GRCm39) V1691D probably damaging Het
Dock9 A C 14: 121,835,149 (GRCm39) L1280R possibly damaging Het
Dync2h1 G A 9: 7,077,999 (GRCm39) S2901F possibly damaging Het
Fkbp8 A G 8: 70,987,529 (GRCm39) K380E probably damaging Het
Ggta1 T C 2: 35,292,422 (GRCm39) Y295C probably damaging Het
Gm7145 A G 1: 117,913,706 (GRCm39) N196S possibly damaging Het
Hectd4 A T 5: 121,448,744 (GRCm39) Y364F probably benign Het
Ighv11-1 T A 12: 113,945,623 (GRCm39) I77L probably benign Het
Kcnmb3 A G 3: 32,536,512 (GRCm39) V72A possibly damaging Het
Kel C T 6: 41,678,971 (GRCm39) G164D probably damaging Het
Krba1 C A 6: 48,389,298 (GRCm39) T606N possibly damaging Het
Lig3 T C 11: 82,674,420 (GRCm39) L82P possibly damaging Het
Limd1 T C 9: 123,308,984 (GRCm39) S228P probably benign Het
Mlf2 C T 6: 124,911,621 (GRCm39) R157W probably benign Het
Naxe T C 3: 87,965,719 (GRCm39) S27G probably benign Het
Oprm1 T A 10: 6,929,694 (GRCm39) C345S probably benign Het
Or4c108 T A 2: 88,804,221 (GRCm39) T5S probably benign Het
Or6c210 A G 10: 129,495,920 (GRCm39) I82V possibly damaging Het
Oscp1 C A 4: 125,970,626 (GRCm39) D138E probably benign Het
Panx3 T A 9: 37,572,992 (GRCm39) Y186F probably damaging Het
Pip5kl1 T C 2: 32,473,391 (GRCm39) Y343H probably damaging Het
Rasgef1b T C 5: 99,382,349 (GRCm39) T214A probably damaging Het
Rims1 C A 1: 22,669,493 (GRCm39) W105L probably null Het
Serpina3f C T 12: 104,184,698 (GRCm39) P281S probably damaging Het
Sgsm1 T C 5: 113,458,418 (GRCm39) K20R probably benign Het
Sigirr A G 7: 140,672,123 (GRCm39) L274P probably damaging Het
Slc44a1 T C 4: 53,491,410 (GRCm39) V49A probably benign Het
Spata31h1 T C 10: 82,118,605 (GRCm39) S4802G unknown Het
Sstr1 G A 12: 58,259,484 (GRCm39) D36N probably benign Het
Stab2 T A 10: 86,790,095 (GRCm39) D557V probably benign Het
Topaz1 GCAGGGGGATGAGAAGGTA G 9: 122,603,934 (GRCm39) probably benign Het
Topaz1 CAGGGGGATGAGAAGGTAAAG CAG 9: 122,603,935 (GRCm39) probably benign Het
Trio G T 15: 27,912,752 (GRCm39) Q101K unknown Het
Vmn1r185 T A 7: 26,310,783 (GRCm39) I241F probably damaging Het
Zfp229 T A 17: 21,965,354 (GRCm39) I528N probably damaging Het
Zfy1 A G Y: 725,476 (GRCm39) F763S possibly damaging Het
Other mutations in 0610030E20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5664:0610030E20Rik UTSW 6 72,325,977 (GRCm39) splice site probably null
R6170:0610030E20Rik UTSW 6 72,325,555 (GRCm39) missense probably benign 0.00
R6284:0610030E20Rik UTSW 6 72,324,437 (GRCm39) missense probably damaging 1.00
R7988:0610030E20Rik UTSW 6 72,324,635 (GRCm39) missense probably damaging 1.00
R8228:0610030E20Rik UTSW 6 72,324,500 (GRCm39) critical splice donor site probably null
R9681:0610030E20Rik UTSW 6 72,324,450 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGTTTTAGCAGCATACCC -3'
(R):5'- CCCCTGTAACAGTGATTCTCAAC -3'

Sequencing Primer
(F):5'- AGCAGCATACCCCCTCTTC -3'
(R):5'- CAGTGATTCTCAACTGAGGGTCAC -3'
Posted On 2022-10-06