Incidental Mutation 'R9726:Dock9'
ID 731061
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, Zizimin1, B230309H04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9726 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 121542046-121797837 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 121597737 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 1280 (L1280R)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000040700
AA Change: L1279R

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: L1279R

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100299
AA Change: L1281R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: L1281R

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212181
AA Change: L1280R

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000212376
AA Change: L1293R

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably damaging
Transcript: ENSMUST00000212416
AA Change: L75R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610030E20Rik T C 6: 72,348,667 V122A probably damaging Het
4932415D10Rik T C 10: 82,282,771 S4802G unknown Het
Ago2 T C 15: 73,127,070 Y226C probably damaging Het
Akap9 A G 5: 4,003,757 K1574R probably benign Het
Apob T C 12: 8,006,926 Y1803H probably damaging Het
Bex6 A T 16: 32,186,425 D17V probably damaging Het
Cd72 T G 4: 43,452,641 probably null Het
Cdcp2 C A 4: 107,102,739 S117Y probably damaging Het
Cenpx A G 11: 120,712,502 L22P unknown Het
Cep135 A G 5: 76,593,304 T76A probably benign Het
Cps1 A T 1: 67,156,236 Q272L probably benign Het
Cul4a C T 8: 13,106,208 P55S probably benign Het
Cyp2f2 C T 7: 27,121,986 T108I probably damaging Het
Dapk1 T C 13: 60,751,134 V806A probably benign Het
Dgki T C 6: 37,299,923 H9R unknown Het
Dmxl2 A T 9: 54,415,712 S1289T probably benign Het
Dock8 T A 19: 25,177,010 V1691D probably damaging Het
Dync2h1 G A 9: 7,077,999 S2901F possibly damaging Het
Fam214b T C 4: 43,034,991 D302G probably damaging Het
Fkbp8 A G 8: 70,534,879 K380E probably damaging Het
Ggta1 T C 2: 35,402,410 Y295C probably damaging Het
Gm13762 T A 2: 88,973,877 T5S probably benign Het
Gm7145 A G 1: 117,985,976 N196S possibly damaging Het
Hectd4 A T 5: 121,310,681 Y364F probably benign Het
Ighv11-1 T A 12: 113,982,003 I77L probably benign Het
Kcnmb3 A G 3: 32,482,363 V72A possibly damaging Het
Kel C T 6: 41,702,037 G164D probably damaging Het
Krba1 C A 6: 48,412,364 T606N possibly damaging Het
Lig3 T C 11: 82,783,594 L82P possibly damaging Het
Limd1 T C 9: 123,479,919 S228P probably benign Het
Mlf2 C T 6: 124,934,658 R157W probably benign Het
Naxe T C 3: 88,058,412 S27G probably benign Het
Olfr800 A G 10: 129,660,051 I82V possibly damaging Het
Oprm1 T A 10: 6,979,694 C345S probably benign Het
Oscp1 C A 4: 126,076,833 D138E probably benign Het
Panx3 T A 9: 37,661,696 Y186F probably damaging Het
Pip5kl1 T C 2: 32,583,379 Y343H probably damaging Het
Rasgef1b T C 5: 99,234,490 T214A probably damaging Het
Rims1 C A 1: 22,630,412 W105L probably null Het
Serpina3f C T 12: 104,218,439 P281S probably damaging Het
Sgsm1 T C 5: 113,310,552 K20R probably benign Het
Sigirr A G 7: 141,092,210 L274P probably damaging Het
Slc44a1 T C 4: 53,491,410 V49A probably benign Het
Sstr1 G A 12: 58,212,698 D36N probably benign Het
Stab2 T A 10: 86,954,231 D557V probably benign Het
Topaz1 GCAGGGGGATGAGAAGGTA G 9: 122,774,869 probably benign Het
Topaz1 CAGGGGGATGAGAAGGTAAAG CAG 9: 122,774,870 probably benign Het
Trio G T 15: 27,912,666 Q101K unknown Het
Vmn1r185 T A 7: 26,611,358 I241F probably damaging Het
Zfp229 T A 17: 21,746,373 I528N probably damaging Het
Zfy1 A G Y: 725,476 F763S possibly damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
R8894:Dock9 UTSW 14 121622961 missense probably benign 0.10
R8900:Dock9 UTSW 14 121580528 missense probably damaging 1.00
R9069:Dock9 UTSW 14 121628912 missense probably damaging 0.98
R9218:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R9233:Dock9 UTSW 14 121583369 missense probably benign 0.09
R9236:Dock9 UTSW 14 121639558 missense probably damaging 1.00
R9285:Dock9 UTSW 14 121595600 missense probably benign
R9451:Dock9 UTSW 14 121550189 splice site probably benign
R9461:Dock9 UTSW 14 121605189 missense probably benign 0.05
R9484:Dock9 UTSW 14 121581432 missense probably damaging 1.00
R9517:Dock9 UTSW 14 121591824 missense probably benign 0.07
R9542:Dock9 UTSW 14 121627363 missense probably damaging 1.00
R9694:Dock9 UTSW 14 121581379 missense probably damaging 1.00
R9701:Dock9 UTSW 14 121639571 missense probably benign 0.01
R9703:Dock9 UTSW 14 121544577 makesense probably null
R9741:Dock9 UTSW 14 121640104 missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTTCTATTACTACTGCATTTAGC -3'
(R):5'- CAGCAACAGTTGTGTGTCAC -3'

Sequencing Primer
(F):5'- AGGAAGAAATTCCCTTAAGTACCTG -3'
(R):5'- TCTTTGTGAACCTGTGCC -3'
Posted On 2022-10-06