Incidental Mutation 'R9727:Igf1r'
ID 731097
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Name insulin-like growth factor I receptor
Synonyms IGF-1R, line 186, A330103N21Rik, hyft, CD221
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9727 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 67602575-67883416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 67857554 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 1078 (V1078D)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000005671
AA Change: V1078D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: V1078D

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin2 A G 4: 34,565,248 (GRCm39) Y165C probably damaging Het
Aox4 A G 1: 58,286,473 (GRCm39) I702V probably benign Het
Arhgef33 A G 17: 80,678,720 (GRCm39) Y472C probably damaging Het
Atp13a4 T G 16: 29,228,589 (GRCm39) S964R Het
Atp1a2 T A 1: 172,118,936 (GRCm39) I69F probably benign Het
Bub1 T C 2: 127,652,609 (GRCm39) D586G possibly damaging Het
Ccdc177 C A 12: 80,806,044 (GRCm39) A77S probably benign Het
Ccdc187 A G 2: 26,171,204 (GRCm39) W425R probably damaging Het
Ccn2 A G 10: 24,471,820 (GRCm39) E37G probably benign Het
Ccsap T C 8: 124,572,169 (GRCm39) D111G possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 114,903,257 (GRCm39) probably benign Het
Ceacam3 C A 7: 16,892,262 (GRCm39) T335K Het
Col22a1 A T 15: 71,849,123 (GRCm39) W322R probably damaging Het
Col5a2 A G 1: 45,415,818 (GRCm39) V1443A possibly damaging Het
Dnah12 C T 14: 26,523,510 (GRCm39) Q2000* probably null Het
Dock7 G T 4: 98,875,568 (GRCm39) T1154K unknown Het
Dot1l T C 10: 80,628,382 (GRCm39) L1140P unknown Het
Dst G A 1: 34,314,877 (GRCm39) V4489M probably damaging Het
Duox2 G A 2: 122,116,998 (GRCm39) R960* probably null Het
Elavl2 T C 4: 91,169,495 (GRCm39) I97V probably benign Het
Emp1 G T 6: 135,358,016 (GRCm39) A121S probably benign Het
Exph5 A T 9: 53,287,702 (GRCm39) R1594S probably damaging Het
Fam186b C T 15: 99,171,669 (GRCm39) M859I probably benign Het
Fat2 A G 11: 55,159,137 (GRCm39) V3345A probably damaging Het
Gtf2f1 A T 17: 57,318,005 (GRCm39) N10K possibly damaging Het
Hid1 T G 11: 115,245,939 (GRCm39) K384N probably damaging Het
Hmcn1 T C 1: 150,674,566 (GRCm39) R579G probably benign Het
Il20rb A T 9: 100,357,001 (GRCm39) M43K probably damaging Het
Kdm3a A T 6: 71,569,094 (GRCm39) Y1134* probably null Het
Kif12 T A 4: 63,085,978 (GRCm39) N429I probably damaging Het
Kif18a C T 2: 109,118,464 (GRCm39) T93I probably damaging Het
Krtap9-5 T A 11: 99,839,340 (GRCm39) C14S possibly damaging Het
Lgals8 A T 13: 12,462,038 (GRCm39) M264K possibly damaging Het
Mlxipl T A 5: 135,150,388 (GRCm39) C143* probably null Het
Mtcl2 T A 2: 156,862,168 (GRCm39) Q1587L possibly damaging Het
Mvp A T 7: 126,595,040 (GRCm39) H268Q probably damaging Het
Ngef G A 1: 87,431,010 (GRCm39) P269L probably damaging Het
Nos2 A G 11: 78,843,825 (GRCm39) Y924C possibly damaging Het
Or4f52 A T 2: 111,061,961 (GRCm39) M59K probably damaging Het
Phf20l1 A G 15: 66,487,231 (GRCm39) N449S probably benign Het
Pot1b A C 17: 55,999,795 (GRCm39) I210S possibly damaging Het
Ptrh1 T A 2: 32,665,854 (GRCm39) W5R probably benign Het
Rasgrp3 A G 17: 75,810,239 (GRCm39) H313R probably damaging Het
Ric1 A T 19: 29,575,258 (GRCm39) I984F probably damaging Het
Rin2 G A 2: 145,702,506 (GRCm39) A401T possibly damaging Het
Rmdn3 C A 2: 118,968,827 (GRCm39) probably null Het
Senp7 A T 16: 55,990,169 (GRCm39) H639L probably benign Het
Sipa1l1 T C 12: 82,471,829 (GRCm39) S1270P probably damaging Het
Slc22a28 T A 19: 8,108,818 (GRCm39) E108V probably benign Het
Slc7a5 A G 8: 122,613,085 (GRCm39) I331T probably benign Het
Smarca4 T C 9: 21,611,160 (GRCm39) Y1467H probably damaging Het
Srebf2 T A 15: 82,076,506 (GRCm39) F759I possibly damaging Het
Thumpd2 A T 17: 81,345,585 (GRCm39) D304E probably damaging Het
Tmem59 A G 4: 107,050,547 (GRCm39) E226G probably benign Het
Trpv1 A C 11: 73,130,347 (GRCm39) D151A probably damaging Het
Txnrd3 A G 6: 89,651,751 (GRCm39) D607G probably benign Het
Ubr4 T A 4: 139,140,735 (GRCm39) V1218E probably damaging Het
Ugt2b5 T A 5: 87,288,165 (GRCm39) M1L probably damaging Het
Vwa5b2 C T 16: 20,423,477 (GRCm39) A1130V probably damaging Het
Wdr4 T C 17: 31,718,045 (GRCm39) E343G probably benign Het
Zbtb34 C A 2: 33,301,533 (GRCm39) R336L probably benign Het
Zfp607b T C 7: 27,403,125 (GRCm39) V527A probably benign Het
Zfp949 T A 9: 88,451,913 (GRCm39) C494* probably null Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 67,839,771 (GRCm39) missense probably benign
IGL00837:Igf1r APN 7 67,851,100 (GRCm39) splice site probably benign
IGL01515:Igf1r APN 7 67,857,200 (GRCm39) missense probably damaging 1.00
IGL01572:Igf1r APN 7 67,843,189 (GRCm39) missense probably benign 0.01
IGL02100:Igf1r APN 7 67,839,706 (GRCm39) missense probably benign 0.05
IGL02506:Igf1r APN 7 67,843,144 (GRCm39) missense probably benign
IGL02672:Igf1r APN 7 67,839,781 (GRCm39) missense probably benign 0.05
IGL02701:Igf1r APN 7 67,850,997 (GRCm39) missense possibly damaging 0.93
IGL02742:Igf1r APN 7 67,839,739 (GRCm39) missense possibly damaging 0.94
IGL03073:Igf1r APN 7 67,864,791 (GRCm39) missense probably damaging 1.00
IGL03257:Igf1r APN 7 67,864,688 (GRCm39) missense probably damaging 1.00
Frufru UTSW 7 67,653,911 (GRCm39) missense probably damaging 1.00
Hungarian UTSW 7 67,864,745 (GRCm39) missense probably damaging 1.00
Mimi UTSW 7 67,844,774 (GRCm39) missense possibly damaging 0.67
Piroshka UTSW 7 67,857,084 (GRCm39) nonsense probably null
Romanian UTSW 7 67,653,885 (GRCm39) missense possibly damaging 0.94
Sublime UTSW 7 67,653,927 (GRCm39) missense probably damaging 1.00
Toy UTSW 7 67,653,720 (GRCm39) missense probably damaging 1.00
BB009:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
BB019:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 67,875,934 (GRCm39) small insertion probably benign
FR4737:Igf1r UTSW 7 67,875,929 (GRCm39) small insertion probably benign
FR4976:Igf1r UTSW 7 67,875,934 (GRCm39) small insertion probably benign
FR4976:Igf1r UTSW 7 67,875,929 (GRCm39) small insertion probably benign
PIT4445001:Igf1r UTSW 7 67,857,211 (GRCm39) missense probably damaging 1.00
R0003:Igf1r UTSW 7 67,814,990 (GRCm39) missense probably damaging 1.00
R0184:Igf1r UTSW 7 67,875,941 (GRCm39) missense possibly damaging 0.84
R0538:Igf1r UTSW 7 67,857,574 (GRCm39) missense probably damaging 1.00
R0632:Igf1r UTSW 7 67,814,903 (GRCm39) missense probably damaging 1.00
R0727:Igf1r UTSW 7 67,861,906 (GRCm39) critical splice donor site probably null
R0750:Igf1r UTSW 7 67,861,839 (GRCm39) missense probably damaging 0.99
R1104:Igf1r UTSW 7 67,844,774 (GRCm39) missense possibly damaging 0.67
R1169:Igf1r UTSW 7 67,814,875 (GRCm39) missense probably benign 0.00
R1348:Igf1r UTSW 7 67,868,216 (GRCm39) missense probably damaging 1.00
R1471:Igf1r UTSW 7 67,653,585 (GRCm39) missense probably damaging 0.98
R1580:Igf1r UTSW 7 67,857,617 (GRCm39) missense probably benign
R1745:Igf1r UTSW 7 67,819,661 (GRCm39) missense probably damaging 1.00
R1772:Igf1r UTSW 7 67,844,822 (GRCm39) missense probably benign 0.03
R1789:Igf1r UTSW 7 67,864,681 (GRCm39) nonsense probably null
R1823:Igf1r UTSW 7 67,844,729 (GRCm39) missense possibly damaging 0.77
R1902:Igf1r UTSW 7 67,850,997 (GRCm39) missense possibly damaging 0.93
R1962:Igf1r UTSW 7 67,857,023 (GRCm39) missense probably damaging 0.99
R2179:Igf1r UTSW 7 67,653,698 (GRCm39) missense probably damaging 0.99
R2215:Igf1r UTSW 7 67,814,982 (GRCm39) missense probably benign
R2221:Igf1r UTSW 7 67,851,710 (GRCm39) missense probably damaging 1.00
R2233:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R2234:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R2235:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R3023:Igf1r UTSW 7 67,833,147 (GRCm39) missense probably benign 0.00
R4044:Igf1r UTSW 7 67,839,810 (GRCm39) missense possibly damaging 0.83
R4226:Igf1r UTSW 7 67,844,826 (GRCm39) nonsense probably null
R4387:Igf1r UTSW 7 67,819,757 (GRCm39) missense probably benign
R4388:Igf1r UTSW 7 67,819,757 (GRCm39) missense probably benign
R4728:Igf1r UTSW 7 67,839,372 (GRCm39) missense probably damaging 1.00
R4781:Igf1r UTSW 7 67,814,947 (GRCm39) missense possibly damaging 0.75
R5254:Igf1r UTSW 7 67,857,067 (GRCm39) missense probably damaging 0.99
R5278:Igf1r UTSW 7 67,843,166 (GRCm39) missense possibly damaging 0.78
R5510:Igf1r UTSW 7 67,843,107 (GRCm39) missense probably benign 0.19
R5522:Igf1r UTSW 7 67,833,258 (GRCm39) missense probably damaging 0.96
R5527:Igf1r UTSW 7 67,857,569 (GRCm39) missense probably damaging 1.00
R5761:Igf1r UTSW 7 67,857,001 (GRCm39) missense probably damaging 1.00
R5849:Igf1r UTSW 7 67,839,781 (GRCm39) missense probably benign
R6189:Igf1r UTSW 7 67,857,084 (GRCm39) nonsense probably null
R6262:Igf1r UTSW 7 67,653,720 (GRCm39) missense probably damaging 1.00
R6285:Igf1r UTSW 7 67,653,885 (GRCm39) missense possibly damaging 0.94
R6318:Igf1r UTSW 7 67,814,981 (GRCm39) missense probably benign 0.02
R6365:Igf1r UTSW 7 67,839,798 (GRCm39) missense probably benign 0.26
R6377:Igf1r UTSW 7 67,850,998 (GRCm39) missense probably benign 0.00
R6831:Igf1r UTSW 7 67,857,067 (GRCm39) missense possibly damaging 0.75
R6848:Igf1r UTSW 7 67,653,927 (GRCm39) missense probably damaging 1.00
R6902:Igf1r UTSW 7 67,653,911 (GRCm39) missense probably damaging 1.00
R7193:Igf1r UTSW 7 67,836,905 (GRCm39) missense probably damaging 1.00
R7373:Igf1r UTSW 7 67,844,826 (GRCm39) nonsense probably null
R7442:Igf1r UTSW 7 67,823,026 (GRCm39) missense probably damaging 1.00
R7903:Igf1r UTSW 7 67,834,500 (GRCm39) missense probably damaging 1.00
R7923:Igf1r UTSW 7 67,839,849 (GRCm39) missense probably damaging 1.00
R7932:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
R8368:Igf1r UTSW 7 67,836,796 (GRCm39) missense probably benign 0.03
R8458:Igf1r UTSW 7 67,845,377 (GRCm39) missense probably benign
R8539:Igf1r UTSW 7 67,653,596 (GRCm39) missense probably benign 0.06
R8704:Igf1r UTSW 7 67,819,802 (GRCm39) splice site probably benign
R8746:Igf1r UTSW 7 67,864,745 (GRCm39) missense probably damaging 1.00
R8829:Igf1r UTSW 7 67,875,769 (GRCm39) missense probably damaging 1.00
R8832:Igf1r UTSW 7 67,875,769 (GRCm39) missense probably damaging 1.00
R8859:Igf1r UTSW 7 67,833,211 (GRCm39) missense possibly damaging 0.75
R9057:Igf1r UTSW 7 67,833,186 (GRCm39) missense probably damaging 1.00
R9243:Igf1r UTSW 7 67,861,775 (GRCm39) missense probably benign 0.11
R9342:Igf1r UTSW 7 67,844,746 (GRCm39) missense probably benign 0.00
R9412:Igf1r UTSW 7 67,857,001 (GRCm39) missense probably damaging 1.00
R9525:Igf1r UTSW 7 67,864,682 (GRCm39) missense probably damaging 1.00
R9730:Igf1r UTSW 7 67,839,423 (GRCm39) missense probably damaging 1.00
R9779:Igf1r UTSW 7 67,654,065 (GRCm39) missense probably damaging 1.00
RF025:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
RF032:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
RF034:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF037:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF039:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF044:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,916 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,930 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,928 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,922 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,917 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,918 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,917 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,921 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTTCCCAGTGGGTAGTTTCC -3'
(R):5'- CATATCTCAAGGCACTCAAGGC -3'

Sequencing Primer
(F):5'- GCATTCTTGCCACCCACAG -3'
(R):5'- CTGAGAAGCAAATGGACTTAAAGAC -3'
Posted On 2022-10-06