Mutagenetix > Incidental Mutation

Incidental Mutation 'R9727:Igf1r'

731097

Institutional Source

Beutler Lab

Gene Symbol

Igf1r

Ensembl Gene

ENSMUSG00000005533

Gene Name

insulin-like growth factor I receptor

Synonyms

line 186, A330103N21Rik, CD221, hyft, IGF-1R

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9727 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

67952827-68233668 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 68207806 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 1078 (V1078D)

Ref Sequence

ENSEMBL: ENSMUSP00000005671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005671]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000005671
AA Change: V1078D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: V1078D

Domain	Start	End	E-Value	Type
Pfam:Recep_L_domain	51	161	1.6e-29	PFAM
FU	227	270	2.98e-12	SMART
Pfam:Recep_L_domain	353	467	3.8e-32	PFAM
FN3	490	593	4.67e-2	SMART
FN3	612	815	1.95e-4	SMART
FN3	833	915	7.4e-5	SMART
low complexity region	937	954	N/A	INTRINSIC
TyrKc	1000	1268	8.51e-141	SMART
low complexity region	1285	1303	N/A	INTRINSIC
low complexity region	1306	1319	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akirin2	A	G	4: 34,565,248	Y165C	probably damaging	Het
Aox4	A	G	1: 58,247,314	I702V	probably benign	Het
Arhgef33	A	G	17: 80,371,291	Y472C	probably damaging	Het
Atp13a4	T	G	16: 29,409,771	S964R		Het
Atp1a2	T	A	1: 172,291,369	I69F	probably benign	Het
Bub1	T	C	2: 127,810,689	D586G	possibly damaging	Het
Ccdc177	C	A	12: 80,759,270	A77S	probably benign	Het
Ccdc187	A	G	2: 26,281,192	W425R	probably damaging	Het
Ccsap	T	C	8: 123,845,430	D111G	possibly damaging	Het
Cd300ld2	CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG	CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG	11: 115,012,431		probably benign	Het
Ceacam3	C	A	7: 17,158,337	T335K		Het
Col22a1	A	T	15: 71,977,274	W322R	probably damaging	Het
Col5a2	A	G	1: 45,376,658	V1443A	possibly damaging	Het
Ctgf	A	G	10: 24,595,922	E37G	probably benign	Het
Dnah12	C	T	14: 26,801,553	Q2000*	probably null	Het
Dock7	G	T	4: 98,987,331	T1154K	unknown	Het
Dot1l	T	C	10: 80,792,548	L1140P	unknown	Het
Dst	G	A	1: 34,275,796	V4489M	probably damaging	Het
Duox2	G	A	2: 122,286,517	R960*	probably null	Het
Elavl2	T	C	4: 91,281,258	I97V	probably benign	Het
Emp1	G	T	6: 135,381,018	A121S	probably benign	Het
Exph5	A	T	9: 53,376,402	R1594S	probably damaging	Het
Fam186b	C	T	15: 99,273,788	M859I	probably benign	Het
Fat2	A	G	11: 55,268,311	V3345A	probably damaging	Het
Gtf2f1	A	T	17: 57,011,005	N10K	possibly damaging	Het
Hid1	T	G	11: 115,355,113	K384N	probably damaging	Het
Hmcn1	T	C	1: 150,798,815	R579G	probably benign	Het
Il20rb	A	T	9: 100,474,948	M43K	probably damaging	Het
Kdm3a	A	T	6: 71,592,110	Y1134*	probably null	Het
Kif12	T	A	4: 63,167,741	N429I	probably damaging	Het
Kif18a	C	T	2: 109,288,119	T93I	probably damaging	Het
Krtap9-5	T	A	11: 99,948,514	C14S	possibly damaging	Het
Lgals8	A	T	13: 12,447,157	M264K	possibly damaging	Het
Mlxipl	T	A	5: 135,121,534	C143*	probably null	Het
Mvp	A	T	7: 126,995,868	H268Q	probably damaging	Het
Ngef	G	A	1: 87,503,288	P269L	probably damaging	Het
Nos2	A	G	11: 78,952,999	Y924C	possibly damaging	Het
Olfr1275	A	T	2: 111,231,616	M59K	probably damaging	Het
Phf20l1	A	G	15: 66,615,382	N449S	probably benign	Het
Pot1b	A	C	17: 55,692,795	I210S	possibly damaging	Het
Ptrh1	T	A	2: 32,775,842	W5R	probably benign	Het
Rasgrp3	A	G	17: 75,503,244	H313R	probably damaging	Het
Ric1	A	T	19: 29,597,858	I984F	probably damaging	Het
Rin2	G	A	2: 145,860,586	A401T	possibly damaging	Het
Rmdn3	C	A	2: 119,138,346		probably null	Het
Senp7	A	T	16: 56,169,806	H639L	probably benign	Het
Sipa1l1	T	C	12: 82,425,055	S1270P	probably damaging	Het
Slc22a28	T	A	19: 8,131,454	E108V	probably benign	Het
Slc7a5	A	G	8: 121,886,346	I331T	probably benign	Het
Smarca4	T	C	9: 21,699,864	Y1467H	probably damaging	Het
Soga1	T	A	2: 157,020,248	Q1587L	possibly damaging	Het
Srebf2	T	A	15: 82,192,305	F759I	possibly damaging	Het
Thumpd2	A	T	17: 81,038,156	D304E	probably damaging	Het
Tmem59	A	G	4: 107,193,350	E226G	probably benign	Het
Trpv1	A	C	11: 73,239,521	D151A	probably damaging	Het
Txnrd3	A	G	6: 89,674,769	D607G	probably benign	Het
Ubr4	T	A	4: 139,413,424	V1218E	probably damaging	Het
Ugt2b5	T	A	5: 87,140,306	M1L	probably damaging	Het
Vwa5b2	C	T	16: 20,604,727	A1130V	probably damaging	Het
Wdr4	T	C	17: 31,499,071	E343G	probably benign	Het
Zbtb34	C	A	2: 33,411,521	R336L	probably benign	Het
Zfp607b	T	C	7: 27,703,700	V527A	probably benign	Het
Zfp949	T	A	9: 88,569,860	C494*	probably null	Het

Other mutations in Igf1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Igf1r	APN	7	68190023	missense	probably benign
IGL00837:Igf1r	APN	7	68201352	splice site	probably benign
IGL01515:Igf1r	APN	7	68207452	missense	probably damaging	1.00
IGL01572:Igf1r	APN	7	68193441	missense	probably benign	0.01
IGL02100:Igf1r	APN	7	68189958	missense	probably benign	0.05
IGL02506:Igf1r	APN	7	68193396	missense	probably benign
IGL02672:Igf1r	APN	7	68190033	missense	probably benign	0.05
IGL02701:Igf1r	APN	7	68201249	missense	possibly damaging	0.93
IGL02742:Igf1r	APN	7	68189991	missense	possibly damaging	0.94
IGL03073:Igf1r	APN	7	68215043	missense	probably damaging	1.00
IGL03257:Igf1r	APN	7	68214940	missense	probably damaging	1.00
Frufru	UTSW	7	68004163	missense	probably damaging	1.00
Hungarian	UTSW	7	68214997	missense	probably damaging	1.00
Mimi	UTSW	7	68195026	missense	possibly damaging	0.67
Piroshka	UTSW	7	68207336	nonsense	probably null
Romanian	UTSW	7	68004137	missense	possibly damaging	0.94
Sublime	UTSW	7	68004179	missense	probably damaging	1.00
Toy	UTSW	7	68003972	missense	probably damaging	1.00
BB009:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
BB019:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
FR4548:Igf1r	UTSW	7	68226186	small insertion	probably benign
FR4737:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226186	small insertion	probably benign
PIT4445001:Igf1r	UTSW	7	68207463	missense	probably damaging	1.00
R0003:Igf1r	UTSW	7	68165242	missense	probably damaging	1.00
R0184:Igf1r	UTSW	7	68226193	missense	possibly damaging	0.84
R0538:Igf1r	UTSW	7	68207826	missense	probably damaging	1.00
R0632:Igf1r	UTSW	7	68165155	missense	probably damaging	1.00
R0727:Igf1r	UTSW	7	68212158	critical splice donor site	probably null
R0750:Igf1r	UTSW	7	68212091	missense	probably damaging	0.99
R1104:Igf1r	UTSW	7	68195026	missense	possibly damaging	0.67
R1169:Igf1r	UTSW	7	68165127	missense	probably benign	0.00
R1348:Igf1r	UTSW	7	68218468	missense	probably damaging	1.00
R1471:Igf1r	UTSW	7	68003837	missense	probably damaging	0.98
R1580:Igf1r	UTSW	7	68207869	missense	probably benign
R1745:Igf1r	UTSW	7	68169913	missense	probably damaging	1.00
R1772:Igf1r	UTSW	7	68195074	missense	probably benign	0.03
R1789:Igf1r	UTSW	7	68214933	nonsense	probably null
R1823:Igf1r	UTSW	7	68194981	missense	possibly damaging	0.77
R1902:Igf1r	UTSW	7	68201249	missense	possibly damaging	0.93
R1962:Igf1r	UTSW	7	68207275	missense	probably damaging	0.99
R2179:Igf1r	UTSW	7	68003950	missense	probably damaging	0.99
R2215:Igf1r	UTSW	7	68165234	missense	probably benign
R2221:Igf1r	UTSW	7	68201962	missense	probably damaging	1.00
R2233:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2234:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2235:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R3023:Igf1r	UTSW	7	68183399	missense	probably benign	0.00
R4044:Igf1r	UTSW	7	68190062	missense	possibly damaging	0.83
R4226:Igf1r	UTSW	7	68195078	nonsense	probably null
R4387:Igf1r	UTSW	7	68170009	missense	probably benign
R4388:Igf1r	UTSW	7	68170009	missense	probably benign
R4728:Igf1r	UTSW	7	68189624	missense	probably damaging	1.00
R4781:Igf1r	UTSW	7	68165199	missense	possibly damaging	0.75
R5254:Igf1r	UTSW	7	68207319	missense	probably damaging	0.99
R5278:Igf1r	UTSW	7	68193418	missense	possibly damaging	0.78
R5510:Igf1r	UTSW	7	68193359	missense	probably benign	0.19
R5522:Igf1r	UTSW	7	68183510	missense	probably damaging	0.96
R5527:Igf1r	UTSW	7	68207821	missense	probably damaging	1.00
R5761:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R5849:Igf1r	UTSW	7	68190033	missense	probably benign
R6189:Igf1r	UTSW	7	68207336	nonsense	probably null
R6262:Igf1r	UTSW	7	68003972	missense	probably damaging	1.00
R6285:Igf1r	UTSW	7	68004137	missense	possibly damaging	0.94
R6318:Igf1r	UTSW	7	68165233	missense	probably benign	0.02
R6365:Igf1r	UTSW	7	68190050	missense	probably benign	0.26
R6377:Igf1r	UTSW	7	68201250	missense	probably benign	0.00
R6831:Igf1r	UTSW	7	68207319	missense	possibly damaging	0.75
R6848:Igf1r	UTSW	7	68004179	missense	probably damaging	1.00
R6902:Igf1r	UTSW	7	68004163	missense	probably damaging	1.00
R7193:Igf1r	UTSW	7	68187157	missense	probably damaging	1.00
R7373:Igf1r	UTSW	7	68195078	nonsense	probably null
R7442:Igf1r	UTSW	7	68173278	missense	probably damaging	1.00
R7903:Igf1r	UTSW	7	68184752	missense	probably damaging	1.00
R7923:Igf1r	UTSW	7	68190101	missense	probably damaging	1.00
R7932:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
R8368:Igf1r	UTSW	7	68187048	missense	probably benign	0.03
R8458:Igf1r	UTSW	7	68195629	missense	probably benign
R8539:Igf1r	UTSW	7	68003848	missense	probably benign	0.06
R8704:Igf1r	UTSW	7	68170054	splice site	probably benign
R8746:Igf1r	UTSW	7	68214997	missense	probably damaging	1.00
R8829:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8832:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8859:Igf1r	UTSW	7	68183463	missense	possibly damaging	0.75
R9057:Igf1r	UTSW	7	68183438	missense	probably damaging	1.00
R9243:Igf1r	UTSW	7	68212027	missense	probably benign	0.11
R9342:Igf1r	UTSW	7	68194998	missense	probably benign	0.00
R9412:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R9525:Igf1r	UTSW	7	68214934	missense	probably damaging	1.00
R9730:Igf1r	UTSW	7	68189675	missense	probably damaging	1.00
R9779:Igf1r	UTSW	7	68004317	missense	probably damaging	1.00
RF025:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF032:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF034:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF037:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF039:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF044:Igf1r	UTSW	7	68226179	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226168	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226174	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226180	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226182	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226170	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226173	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- CTTCCCAGTGGGTAGTTTCC -3'
(R):5'- CATATCTCAAGGCACTCAAGGC -3'

Sequencing Primer
(F):5'- GCATTCTTGCCACCCACAG -3'
(R):5'- CTGAGAAGCAAATGGACTTAAAGAC -3'

Posted On

2022-10-06