Incidental Mutation 'R9727:Nos2'
ID 731109
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms iNOS, Nos-2, Nos2a, NOS-II
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9727 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 78920787-78960254 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78952999 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 924 (Y924C)
Ref Sequence ENSEMBL: ENSMUSP00000018610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
AlphaFold P29477
PDB Structure MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DOMAIN (DELTA 114) (N-[(1,3-BENZODIOXOL-5-YL)METHYL]-1-[2-(1H-IMIDAZOL-1-YL)PYRIMIDIN-4-YL]-4-(METHOXYCARBONYL)-PIPERAZINE-2-ACETAMIDE COMPLEX [X-RAY DIFFRACTION]
MURINE INOSOXY DIMER WITH ISOTHIOUREA BOUND IN THE ACTIVE SITE [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND 4-AMINO TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND DIHYDROBIOPTERIN [X-RAY DIFFRACTION]
MURINE INDUCIBLE NITRIC OXIDE SYNTHASE OXYGENASE DIMER N-HYDROXYARGININE AND TETRAHYDROBIOPTERIN [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457F Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
Murine Inducible Nitric Oxide Synthase Oxygenase Dimer (Delta 65) with W457A Mutation at Tetrahydrobiopterin Binding Site [X-RAY DIFFRACTION]
inducible nitric oxide synthase with Chlorzoxazone bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 7-nitroindazole bound [X-RAY DIFFRACTION]
inducible nitric oxide synthase with 6-nitroindazole bound [X-RAY DIFFRACTION]
>> 40 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000018610
AA Change: Y924C

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: Y924C

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214397
AA Change: Y811C

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin2 A G 4: 34,565,248 Y165C probably damaging Het
Aox4 A G 1: 58,247,314 I702V probably benign Het
Arhgef33 A G 17: 80,371,291 Y472C probably damaging Het
Atp13a4 T G 16: 29,409,771 S964R Het
Atp1a2 T A 1: 172,291,369 I69F probably benign Het
Bub1 T C 2: 127,810,689 D586G possibly damaging Het
Ccdc177 C A 12: 80,759,270 A77S probably benign Het
Ccdc187 A G 2: 26,281,192 W425R probably damaging Het
Ccsap T C 8: 123,845,430 D111G possibly damaging Het
Cd300ld2 CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG 11: 115,012,431 probably benign Het
Ceacam3 C A 7: 17,158,337 T335K Het
Col22a1 A T 15: 71,977,274 W322R probably damaging Het
Col5a2 A G 1: 45,376,658 V1443A possibly damaging Het
Ctgf A G 10: 24,595,922 E37G probably benign Het
Dnah12 C T 14: 26,801,553 Q2000* probably null Het
Dock7 G T 4: 98,987,331 T1154K unknown Het
Dot1l T C 10: 80,792,548 L1140P unknown Het
Dst G A 1: 34,275,796 V4489M probably damaging Het
Duox2 G A 2: 122,286,517 R960* probably null Het
Elavl2 T C 4: 91,281,258 I97V probably benign Het
Emp1 G T 6: 135,381,018 A121S probably benign Het
Exph5 A T 9: 53,376,402 R1594S probably damaging Het
Fam186b C T 15: 99,273,788 M859I probably benign Het
Fat2 A G 11: 55,268,311 V3345A probably damaging Het
Gtf2f1 A T 17: 57,011,005 N10K possibly damaging Het
Hid1 T G 11: 115,355,113 K384N probably damaging Het
Hmcn1 T C 1: 150,798,815 R579G probably benign Het
Igf1r T A 7: 68,207,806 V1078D probably damaging Het
Il20rb A T 9: 100,474,948 M43K probably damaging Het
Kdm3a A T 6: 71,592,110 Y1134* probably null Het
Kif12 T A 4: 63,167,741 N429I probably damaging Het
Kif18a C T 2: 109,288,119 T93I probably damaging Het
Krtap9-5 T A 11: 99,948,514 C14S possibly damaging Het
Lgals8 A T 13: 12,447,157 M264K possibly damaging Het
Mlxipl T A 5: 135,121,534 C143* probably null Het
Mvp A T 7: 126,995,868 H268Q probably damaging Het
Ngef G A 1: 87,503,288 P269L probably damaging Het
Olfr1275 A T 2: 111,231,616 M59K probably damaging Het
Phf20l1 A G 15: 66,615,382 N449S probably benign Het
Pot1b A C 17: 55,692,795 I210S possibly damaging Het
Ptrh1 T A 2: 32,775,842 W5R probably benign Het
Rasgrp3 A G 17: 75,503,244 H313R probably damaging Het
Ric1 A T 19: 29,597,858 I984F probably damaging Het
Rin2 G A 2: 145,860,586 A401T possibly damaging Het
Rmdn3 C A 2: 119,138,346 probably null Het
Senp7 A T 16: 56,169,806 H639L probably benign Het
Sipa1l1 T C 12: 82,425,055 S1270P probably damaging Het
Slc22a28 T A 19: 8,131,454 E108V probably benign Het
Slc7a5 A G 8: 121,886,346 I331T probably benign Het
Smarca4 T C 9: 21,699,864 Y1467H probably damaging Het
Soga1 T A 2: 157,020,248 Q1587L possibly damaging Het
Srebf2 T A 15: 82,192,305 F759I possibly damaging Het
Thumpd2 A T 17: 81,038,156 D304E probably damaging Het
Tmem59 A G 4: 107,193,350 E226G probably benign Het
Trpv1 A C 11: 73,239,521 D151A probably damaging Het
Txnrd3 A G 6: 89,674,769 D607G probably benign Het
Ubr4 T A 4: 139,413,424 V1218E probably damaging Het
Ugt2b5 T A 5: 87,140,306 M1L probably damaging Het
Vwa5b2 C T 16: 20,604,727 A1130V probably damaging Het
Wdr4 T C 17: 31,499,071 E343G probably benign Het
Zbtb34 C A 2: 33,411,521 R336L probably benign Het
Zfp607b T C 7: 27,703,700 V527A probably benign Het
Zfp949 T A 9: 88,569,860 C494* probably null Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78957452 missense probably damaging 0.96
IGL01503:Nos2 APN 11 78945863 splice site probably benign
IGL01789:Nos2 APN 11 78944657 splice site probably benign
IGL02797:Nos2 APN 11 78940344 missense probably damaging 1.00
IGL02968:Nos2 APN 11 78937637 missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78959748 missense possibly damaging 0.90
R0035:Nos2 UTSW 11 78945727 missense probably damaging 1.00
R0265:Nos2 UTSW 11 78937602 missense probably damaging 0.98
R0441:Nos2 UTSW 11 78928583 missense probably benign 0.10
R0504:Nos2 UTSW 11 78940077 missense probably damaging 1.00
R0570:Nos2 UTSW 11 78935361 missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78952803 missense probably benign 0.00
R1538:Nos2 UTSW 11 78956570 missense probably benign 0.00
R3414:Nos2 UTSW 11 78957588 missense probably benign 0.14
R3418:Nos2 UTSW 11 78959695 missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78929776 missense probably benign 0.01
R4492:Nos2 UTSW 11 78950095 missense probably benign
R4632:Nos2 UTSW 11 78957591 missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78928630 missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78922314 missense probably benign
R5214:Nos2 UTSW 11 78955441 missense probably damaging 1.00
R5377:Nos2 UTSW 11 78957491 missense probably benign 0.00
R5777:Nos2 UTSW 11 78940152 missense probably null 1.00
R5834:Nos2 UTSW 11 78928579 missense probably benign 0.01
R5930:Nos2 UTSW 11 78937915 missense probably damaging 1.00
R6511:Nos2 UTSW 11 78955464 splice site probably null
R6706:Nos2 UTSW 11 78944723 missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78952954 missense probably damaging 0.99
R6762:Nos2 UTSW 11 78959748 missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78945266 missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78957506 missense probably benign 0.02
R6917:Nos2 UTSW 11 78951227 missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78928579 missense probably benign 0.02
R7286:Nos2 UTSW 11 78929854 missense probably damaging 1.00
R7367:Nos2 UTSW 11 78950090 missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78936471 nonsense probably null
R7411:Nos2 UTSW 11 78944855 critical splice donor site probably null
R7469:Nos2 UTSW 11 78952971 missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78922366 nonsense probably null
R8694:Nos2 UTSW 11 78945689 missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78955464 splice site probably null
R8872:Nos2 UTSW 11 78949123 missense probably damaging 0.99
R8952:Nos2 UTSW 11 78945263 missense probably benign 0.00
R9433:Nos2 UTSW 11 78959664 missense probably damaging 1.00
R9580:Nos2 UTSW 11 78937631 missense probably benign 0.01
R9612:Nos2 UTSW 11 78949158 missense probably damaging 1.00
R9747:Nos2 UTSW 11 78931646 missense probably damaging 0.96
X0063:Nos2 UTSW 11 78922367 missense probably benign 0.01
Z1177:Nos2 UTSW 11 78931672 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGAAGTTCAGCAACAACC -3'
(R):5'- GCCCCAAGGTATTGAACAGCTG -3'

Sequencing Primer
(F):5'- AACCCCACGTTCCTGGAG -3'
(R):5'- CAATAAGCAACGTTCCTCTGTGG -3'
Posted On 2022-10-06