Mutagenetix > Incidental Mutation

Incidental Mutation 'R9729:Nup210l'

731208

Institutional Source

Beutler Lab

Gene Symbol

Nup210l

Ensembl Gene

ENSMUSG00000027939

Gene Name

nucleoporin 210-like

Synonyms

4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.403) question?

Stock #

R9729 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

90104132-90212048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 90199866 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 1570 (P1570L)

Ref Sequence

ENSEMBL: ENSMUSP00000029548 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]

AlphaFold

Q9D2F7

Predicted Effect

probably benign
Transcript: ENSMUST00000029548
AA Change: P1570L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: P1570L

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
BID_2	457	536	2.05e1	SMART
Blast:S1	949	1023	2e-16	BLAST
BID_2	1077	1152	4.51e-11	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200410
AA Change: P1570L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: P1570L

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
BID_2	457	536	6.9e-2	SMART
Blast:S1	938	1023	9e-17	BLAST
BID_2	1077	1152	1.5e-13	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833439L19Rik	A	T	13: 54,552,706	M273K	probably benign	Het
Aar2	A	G	2: 156,551,441	D250G	probably benign	Het
Acly	T	A	11: 100,516,885	Y213F	probably benign	Het
Adgrg5	G	A	8: 94,941,505	M399I		Het
Adhfe1	T	C	1: 9,553,409	L95P	probably damaging	Het
Ano7	G	A	1: 93,394,458	C396Y	probably damaging	Het
Apob	T	A	12: 8,016,125	Y4365N	probably damaging	Het
Arfgap3	C	T	15: 83,308,165	R411H	probably damaging	Het
Bbs7	T	C	3: 36,607,669	Y127C	probably damaging	Het
Cadps2	T	C	6: 23,382,983	T793A	probably benign	Het
Casp8ap2	T	A	4: 32,643,807	V960E	possibly damaging	Het
Cdkl3	A	G	11: 52,004,943	T6A	probably benign	Het
Cdkn2aip	T	C	8: 47,713,619	D51G	probably benign	Het
Cdpf1	G	T	15: 85,808,326	S52*	probably null	Het
Celf5	T	A	10: 81,468,091	D177V	probably damaging	Het
Cep164	A	G	9: 45,771,599	V931A	probably damaging	Het
Cog6	T	C	3: 52,993,486	D457G	probably damaging	Het
Col4a2	G	T	8: 11,446,157	V1593L	probably benign	Het
Dlg5	C	G	14: 24,154,613	M1287I	probably benign	Het
Dmrt1	T	C	19: 25,545,998	S238P	probably benign	Het
Dpysl2	A	G	14: 66,862,478	M103T	probably benign	Het
Emsy	C	A	7: 98,613,049	A608S	probably benign	Het
Exoc5	A	T	14: 49,015,629	C576S	probably damaging	Het
F830016B08Rik	G	A	18: 60,300,486	V214M	possibly damaging	Het
Fam189a1	C	T	7: 65,156,308	G6S	probably benign	Het
Fignl1	A	G	11: 11,802,219	S279P	probably benign	Het
Gimap1	A	G	6: 48,742,452	R71G	unknown	Het
Gm26727	A	T	2: 67,432,919	M88K	probably damaging	Het
Gm45861	T	A	8: 27,555,408	W1066R	unknown	Het
Gm609	G	T	16: 45,443,874	T107N	possibly damaging	Het
Gpr15	A	G	16: 58,717,886	L280S	possibly damaging	Het
Grin1	C	T	2: 25,297,410	W629*	probably null	Het
Grk5	C	T	19: 61,090,029	P508L	possibly damaging	Het
Hgf	A	T	5: 16,561,031	D55V	probably damaging	Het
Hipk1	T	A	3: 103,761,574	D502V	probably damaging	Het
Kmt2c	T	C	5: 25,284,760	K4394E	probably damaging	Het
Llgl2	A	G	11: 115,849,641	T388A	probably damaging	Het
Lsm14a	G	T	7: 34,389,473	S2R	probably damaging	Het
Madd	A	T	2: 91,170,199	M507K	possibly damaging	Het
Map2k3	G	T	11: 60,946,646	V191L		Het
Mapk8ip1	A	G	2: 92,386,715	S421P	probably damaging	Het
March7	C	T	2: 60,234,441	R354*	probably null	Het
Myc	T	G	15: 61,988,086	C204G	probably damaging	Het
Nampt	A	G	12: 32,850,529	H491R	possibly damaging	Het
Noct	C	T	3: 51,249,846	Q202*	probably null	Het
Olfr1358	T	A	10: 78,520,115	F169Y	probably damaging	Het
Osbpl10	G	A	9: 115,223,736	V451M	probably damaging	Het
Osr2	T	A	15: 35,302,915	F312Y	probably benign	Het
Parp16	A	T	9: 65,229,815	I108F	possibly damaging	Het
Parp4	A	G	14: 56,648,431	T1656A	unknown	Het
Pnpla8	A	G	12: 44,283,874	I374V	probably benign	Het
Prss23	T	C	7: 89,510,723	N46S	probably benign	Het
Ptger2	T	C	14: 44,989,019	W19R	possibly damaging	Het
Rbl2	T	C	8: 91,078,899	S195P	probably damaging	Het
Rnf169	C	T	7: 99,926,270	V373I	probably damaging	Het
Sclt1	C	A	3: 41,675,402	E325*	probably null	Het
Sdccag3	A	G	2: 26,388,633	F21S	unknown	Het
Sergef	C	T	7: 46,635,489	S43N	probably benign	Het
Slc35f3	CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC	8: 126,389,038		probably benign	Het
Slc3a2	T	C	19: 8,708,006	D472G	probably damaging	Het
Slc43a3	T	C	2: 84,950,456	F342L	probably benign	Het
Slc44a4	A	T	17: 34,921,694	I288F	probably benign	Het
Snupn	T	A	9: 56,970,631	N151K	possibly damaging	Het
Srbd1	A	T	17: 86,130,122	D264E	probably benign	Het
Srpr	A	T	9: 35,214,273	T378S	probably benign	Het
Stat4	A	G	1: 52,102,603	D613G	possibly damaging	Het
Sycp2l	C	T	13: 41,172,656	P246L		Het
Tcf20	T	C	15: 82,851,836	R1805G	probably benign	Het
Tob1	T	A	11: 94,214,054	F139I	probably damaging	Het
Traj9	A	G	14: 54,209,414	T8A	unknown	Het
Trank1	G	T	9: 111,391,469	D2425Y	probably damaging	Het
Ttn	A	T	2: 76,746,923	M24542K	probably damaging	Het
Ttn	G	A	2: 76,907,727	S4202L	unknown	Het
Vcam1	T	C	3: 116,117,456	Y431C	probably damaging	Het
Vcpkmt	G	A	12: 69,581,162	R175C	probably damaging	Het
Vmn2r51	A	T	7: 10,105,552	D36E	probably benign	Het
Vmn2r61	A	G	7: 42,300,493	E779G	probably damaging	Het
Zfp831	T	C	2: 174,646,145	L871P	possibly damaging	Het

Other mutations in Nup210l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Nup210l	APN	3	90190849	splice site	probably benign
IGL00813:Nup210l	APN	3	90132418	missense	probably benign	0.00
IGL01375:Nup210l	APN	3	90159893	missense	probably damaging	0.96
IGL01731:Nup210l	APN	3	90154566	missense	probably damaging	1.00
IGL01786:Nup210l	APN	3	90122776	nonsense	probably null
IGL01958:Nup210l	APN	3	90203924	missense	possibly damaging	0.74
IGL02094:Nup210l	APN	3	90180213	critical splice donor site	probably null
IGL02120:Nup210l	APN	3	90136862	missense	probably damaging	1.00
IGL02313:Nup210l	APN	3	90122792	missense	probably damaging	1.00
IGL02336:Nup210l	APN	3	90181552	critical splice donor site	probably null
IGL02348:Nup210l	APN	3	90104164	utr 5 prime	probably benign
IGL02372:Nup210l	APN	3	90201971	missense	possibly damaging	0.80
IGL02557:Nup210l	APN	3	90124230	missense	probably damaging	1.00
IGL02559:Nup210l	APN	3	90159953	missense	probably benign	0.02
IGL02738:Nup210l	APN	3	90136850	missense	possibly damaging	0.80
IGL03231:Nup210l	APN	3	90189545	missense	probably damaging	1.00
IGL03257:Nup210l	APN	3	90180148	critical splice acceptor site	probably null
IGL03388:Nup210l	APN	3	90170044	missense	probably damaging	1.00
IGL03134:Nup210l	UTSW	3	90190887	missense	possibly damaging	0.85
R0003:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R0040:Nup210l	UTSW	3	90181905	missense	probably damaging	1.00
R0083:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0090:Nup210l	UTSW	3	90211779	missense	probably benign	0.00
R0108:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0142:Nup210l	UTSW	3	90172113	missense	probably damaging	1.00
R0306:Nup210l	UTSW	3	90207368	missense	probably benign	0.13
R0332:Nup210l	UTSW	3	90132309	splice site	probably benign
R0346:Nup210l	UTSW	3	90189438	missense	probably damaging	1.00
R0463:Nup210l	UTSW	3	90180211	missense	probably null	1.00
R0622:Nup210l	UTSW	3	90167740	missense	probably damaging	0.98
R0765:Nup210l	UTSW	3	90119877	missense	probably damaging	0.99
R0990:Nup210l	UTSW	3	90211925	missense	probably benign	0.00
R1014:Nup210l	UTSW	3	90170048	missense	possibly damaging	0.62
R1036:Nup210l	UTSW	3	90192940	splice site	probably benign
R1177:Nup210l	UTSW	3	90202003	missense	probably benign	0.11
R1183:Nup210l	UTSW	3	90159945	missense	probably benign	0.04
R1188:Nup210l	UTSW	3	90198179	missense	probably benign	0.16
R1457:Nup210l	UTSW	3	90190972	missense	possibly damaging	0.68
R1471:Nup210l	UTSW	3	90170562	missense	probably benign
R1627:Nup210l	UTSW	3	90144169	missense	probably benign	0.15
R1778:Nup210l	UTSW	3	90189486	missense	probably damaging	0.99
R1827:Nup210l	UTSW	3	90154557	missense	probably damaging	1.00
R1843:Nup210l	UTSW	3	90172086	missense	probably damaging	0.96
R1858:Nup210l	UTSW	3	90154499	missense	probably damaging	0.97
R1942:Nup210l	UTSW	3	90151237	missense	probably benign	0.01
R2015:Nup210l	UTSW	3	90185432	missense	probably damaging	1.00
R2113:Nup210l	UTSW	3	90190974	missense	possibly damaging	0.48
R2944:Nup210l	UTSW	3	90181545	missense	probably damaging	1.00
R3736:Nup210l	UTSW	3	90120013	missense	probably damaging	1.00
R3740:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3741:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3742:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3771:Nup210l	UTSW	3	90119894	nonsense	probably null
R3773:Nup210l	UTSW	3	90119894	nonsense	probably null
R3879:Nup210l	UTSW	3	90185473	missense	probably damaging	1.00
R3882:Nup210l	UTSW	3	90124210	missense	probably benign	0.19
R3953:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3954:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3955:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3956:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R4200:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R4290:Nup210l	UTSW	3	90207326	missense	probably benign	0.00
R4328:Nup210l	UTSW	3	90175835	splice site	probably null
R4629:Nup210l	UTSW	3	90167875	missense	probably benign	0.21
R4629:Nup210l	UTSW	3	90190874	nonsense	probably null
R4897:Nup210l	UTSW	3	90193071	missense	probably damaging	1.00
R4906:Nup210l	UTSW	3	90170030	missense	probably benign	0.06
R4966:Nup210l	UTSW	3	90106901	missense	probably benign	0.00
R5004:Nup210l	UTSW	3	90180165	nonsense	probably null
R5237:Nup210l	UTSW	3	90180198	missense	probably benign	0.00
R5499:Nup210l	UTSW	3	90174370	missense	probably damaging	1.00
R5522:Nup210l	UTSW	3	90154665	missense	probably benign	0.10
R5627:Nup210l	UTSW	3	90144250	missense	probably damaging	0.97
R5678:Nup210l	UTSW	3	90190959	missense	probably damaging	0.99
R5726:Nup210l	UTSW	3	90129207	splice site	probably null
R5792:Nup210l	UTSW	3	90199857	missense	probably damaging	1.00
R6129:Nup210l	UTSW	3	90104176	missense	probably benign	0.00
R6272:Nup210l	UTSW	3	90170024	missense	possibly damaging	0.57
R6290:Nup210l	UTSW	3	90119909	nonsense	probably null
R6293:Nup210l	UTSW	3	90115064	missense	probably damaging	1.00
R6446:Nup210l	UTSW	3	90172068	missense	probably damaging	1.00
R6698:Nup210l	UTSW	3	90182508	missense	possibly damaging	0.57
R6855:Nup210l	UTSW	3	90136924	missense	probably benign	0.01
R6895:Nup210l	UTSW	3	90159924	missense	probably damaging	0.97
R6899:Nup210l	UTSW	3	90167897	missense	possibly damaging	0.77
R6978:Nup210l	UTSW	3	90154566	missense	possibly damaging	0.86
R6980:Nup210l	UTSW	3	90119927	missense	probably benign	0.04
R7038:Nup210l	UTSW	3	90159947	missense	probably damaging	1.00
R7273:Nup210l	UTSW	3	90118547	missense	probably benign	0.04
R7450:Nup210l	UTSW	3	90115188	critical splice donor site	probably null
R7514:Nup210l	UTSW	3	90210459	critical splice donor site	probably null
R7658:Nup210l	UTSW	3	90211993	missense	probably benign	0.43
R7735:Nup210l	UTSW	3	90185576	missense	probably damaging	1.00
R7772:Nup210l	UTSW	3	90159926	missense	probably damaging	1.00
R7800:Nup210l	UTSW	3	90134597	missense	probably damaging	1.00
R7840:Nup210l	UTSW	3	90122729	missense	probably benign	0.08
R7847:Nup210l	UTSW	3	90151123	missense	probably benign
R7848:Nup210l	UTSW	3	90203905	missense	probably benign	0.01
R8084:Nup210l	UTSW	3	90136058	missense	probably benign	0.15
R8121:Nup210l	UTSW	3	90115121	missense	probably damaging	1.00
R8421:Nup210l	UTSW	3	90203867	missense	probably damaging	1.00
R8458:Nup210l	UTSW	3	90185567	missense	probably null	1.00
R8701:Nup210l	UTSW	3	90122814	missense	probably benign	0.41
R8720:Nup210l	UTSW	3	90210374	missense	probably benign	0.00
R8770:Nup210l	UTSW	3	90118543	missense	probably damaging	1.00
R8896:Nup210l	UTSW	3	90118625	missense	probably damaging	1.00
R9033:Nup210l	UTSW	3	90198089	missense	probably benign
R9371:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9373:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9381:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9426:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9427:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9501:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9523:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9574:Nup210l	UTSW	3	90210386	missense	probably benign
R9612:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9654:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9660:Nup210l	UTSW	3	90198095	missense	probably benign	0.30
R9660:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9662:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9682:Nup210l	UTSW	3	90144162	missense	possibly damaging	0.79
R9750:Nup210l	UTSW	3	90210352	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGCATGCACCCACATTCC -3'
(R):5'- AGGTATTTACTACTAAGCATAGCCA -3'

Sequencing Primer
(F):5'- CTGAGGACAGCTACAGTGTACTTAC -3'
(R):5'- CTGTGGAGAAACTCCTTACC -3'

Posted On

2022-10-06