Incidental Mutation 'R9729:Nup210l'
ID 731208
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock # R9729 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 90104132-90212048 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 90199866 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 1570 (P1570L)
Ref Sequence ENSEMBL: ENSMUSP00000029548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably benign
Transcript: ENSMUST00000029548
AA Change: P1570L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: P1570L

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200410
AA Change: P1570L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: P1570L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A T 13: 54,552,706 M273K probably benign Het
Aar2 A G 2: 156,551,441 D250G probably benign Het
Acly T A 11: 100,516,885 Y213F probably benign Het
Adgrg5 G A 8: 94,941,505 M399I Het
Adhfe1 T C 1: 9,553,409 L95P probably damaging Het
Ano7 G A 1: 93,394,458 C396Y probably damaging Het
Apob T A 12: 8,016,125 Y4365N probably damaging Het
Arfgap3 C T 15: 83,308,165 R411H probably damaging Het
Bbs7 T C 3: 36,607,669 Y127C probably damaging Het
Cadps2 T C 6: 23,382,983 T793A probably benign Het
Casp8ap2 T A 4: 32,643,807 V960E possibly damaging Het
Cdkl3 A G 11: 52,004,943 T6A probably benign Het
Cdkn2aip T C 8: 47,713,619 D51G probably benign Het
Cdpf1 G T 15: 85,808,326 S52* probably null Het
Celf5 T A 10: 81,468,091 D177V probably damaging Het
Cep164 A G 9: 45,771,599 V931A probably damaging Het
Cog6 T C 3: 52,993,486 D457G probably damaging Het
Col4a2 G T 8: 11,446,157 V1593L probably benign Het
Dlg5 C G 14: 24,154,613 M1287I probably benign Het
Dmrt1 T C 19: 25,545,998 S238P probably benign Het
Dpysl2 A G 14: 66,862,478 M103T probably benign Het
Emsy C A 7: 98,613,049 A608S probably benign Het
Exoc5 A T 14: 49,015,629 C576S probably damaging Het
F830016B08Rik G A 18: 60,300,486 V214M possibly damaging Het
Fam189a1 C T 7: 65,156,308 G6S probably benign Het
Fignl1 A G 11: 11,802,219 S279P probably benign Het
Gimap1 A G 6: 48,742,452 R71G unknown Het
Gm26727 A T 2: 67,432,919 M88K probably damaging Het
Gm45861 T A 8: 27,555,408 W1066R unknown Het
Gm609 G T 16: 45,443,874 T107N possibly damaging Het
Gpr15 A G 16: 58,717,886 L280S possibly damaging Het
Grin1 C T 2: 25,297,410 W629* probably null Het
Grk5 C T 19: 61,090,029 P508L possibly damaging Het
Hgf A T 5: 16,561,031 D55V probably damaging Het
Hipk1 T A 3: 103,761,574 D502V probably damaging Het
Kmt2c T C 5: 25,284,760 K4394E probably damaging Het
Llgl2 A G 11: 115,849,641 T388A probably damaging Het
Lsm14a G T 7: 34,389,473 S2R probably damaging Het
Madd A T 2: 91,170,199 M507K possibly damaging Het
Map2k3 G T 11: 60,946,646 V191L Het
Mapk8ip1 A G 2: 92,386,715 S421P probably damaging Het
March7 C T 2: 60,234,441 R354* probably null Het
Myc T G 15: 61,988,086 C204G probably damaging Het
Nampt A G 12: 32,850,529 H491R possibly damaging Het
Noct C T 3: 51,249,846 Q202* probably null Het
Olfr1358 T A 10: 78,520,115 F169Y probably damaging Het
Osbpl10 G A 9: 115,223,736 V451M probably damaging Het
Osr2 T A 15: 35,302,915 F312Y probably benign Het
Parp16 A T 9: 65,229,815 I108F possibly damaging Het
Parp4 A G 14: 56,648,431 T1656A unknown Het
Pnpla8 A G 12: 44,283,874 I374V probably benign Het
Prss23 T C 7: 89,510,723 N46S probably benign Het
Ptger2 T C 14: 44,989,019 W19R possibly damaging Het
Rbl2 T C 8: 91,078,899 S195P probably damaging Het
Rnf169 C T 7: 99,926,270 V373I probably damaging Het
Sclt1 C A 3: 41,675,402 E325* probably null Het
Sdccag3 A G 2: 26,388,633 F21S unknown Het
Sergef C T 7: 46,635,489 S43N probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 126,389,038 probably benign Het
Slc3a2 T C 19: 8,708,006 D472G probably damaging Het
Slc43a3 T C 2: 84,950,456 F342L probably benign Het
Slc44a4 A T 17: 34,921,694 I288F probably benign Het
Snupn T A 9: 56,970,631 N151K possibly damaging Het
Srbd1 A T 17: 86,130,122 D264E probably benign Het
Srpr A T 9: 35,214,273 T378S probably benign Het
Stat4 A G 1: 52,102,603 D613G possibly damaging Het
Sycp2l C T 13: 41,172,656 P246L Het
Tcf20 T C 15: 82,851,836 R1805G probably benign Het
Tob1 T A 11: 94,214,054 F139I probably damaging Het
Traj9 A G 14: 54,209,414 T8A unknown Het
Trank1 G T 9: 111,391,469 D2425Y probably damaging Het
Ttn A T 2: 76,746,923 M24542K probably damaging Het
Ttn G A 2: 76,907,727 S4202L unknown Het
Vcam1 T C 3: 116,117,456 Y431C probably damaging Het
Vcpkmt G A 12: 69,581,162 R175C probably damaging Het
Vmn2r51 A T 7: 10,105,552 D36E probably benign Het
Vmn2r61 A G 7: 42,300,493 E779G probably damaging Het
Zfp831 T C 2: 174,646,145 L871P possibly damaging Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90190849 splice site probably benign
IGL00813:Nup210l APN 3 90132418 missense probably benign 0.00
IGL01375:Nup210l APN 3 90159893 missense probably damaging 0.96
IGL01731:Nup210l APN 3 90154566 missense probably damaging 1.00
IGL01786:Nup210l APN 3 90122776 nonsense probably null
IGL01958:Nup210l APN 3 90203924 missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90180213 critical splice donor site probably null
IGL02120:Nup210l APN 3 90136862 missense probably damaging 1.00
IGL02313:Nup210l APN 3 90122792 missense probably damaging 1.00
IGL02336:Nup210l APN 3 90181552 critical splice donor site probably null
IGL02348:Nup210l APN 3 90104164 utr 5 prime probably benign
IGL02372:Nup210l APN 3 90201971 missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90124230 missense probably damaging 1.00
IGL02559:Nup210l APN 3 90159953 missense probably benign 0.02
IGL02738:Nup210l APN 3 90136850 missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90189545 missense probably damaging 1.00
IGL03257:Nup210l APN 3 90180148 critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90170044 missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90190887 missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R0040:Nup210l UTSW 3 90181905 missense probably damaging 1.00
R0083:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0090:Nup210l UTSW 3 90211779 missense probably benign 0.00
R0108:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0142:Nup210l UTSW 3 90172113 missense probably damaging 1.00
R0306:Nup210l UTSW 3 90207368 missense probably benign 0.13
R0332:Nup210l UTSW 3 90132309 splice site probably benign
R0346:Nup210l UTSW 3 90189438 missense probably damaging 1.00
R0463:Nup210l UTSW 3 90180211 missense probably null 1.00
R0622:Nup210l UTSW 3 90167740 missense probably damaging 0.98
R0765:Nup210l UTSW 3 90119877 missense probably damaging 0.99
R0990:Nup210l UTSW 3 90211925 missense probably benign 0.00
R1014:Nup210l UTSW 3 90170048 missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90192940 splice site probably benign
R1177:Nup210l UTSW 3 90202003 missense probably benign 0.11
R1183:Nup210l UTSW 3 90159945 missense probably benign 0.04
R1188:Nup210l UTSW 3 90198179 missense probably benign 0.16
R1457:Nup210l UTSW 3 90190972 missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90170562 missense probably benign
R1627:Nup210l UTSW 3 90144169 missense probably benign 0.15
R1778:Nup210l UTSW 3 90189486 missense probably damaging 0.99
R1827:Nup210l UTSW 3 90154557 missense probably damaging 1.00
R1843:Nup210l UTSW 3 90172086 missense probably damaging 0.96
R1858:Nup210l UTSW 3 90154499 missense probably damaging 0.97
R1942:Nup210l UTSW 3 90151237 missense probably benign 0.01
R2015:Nup210l UTSW 3 90185432 missense probably damaging 1.00
R2113:Nup210l UTSW 3 90190974 missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90181545 missense probably damaging 1.00
R3736:Nup210l UTSW 3 90120013 missense probably damaging 1.00
R3740:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3741:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3742:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3771:Nup210l UTSW 3 90119894 nonsense probably null
R3773:Nup210l UTSW 3 90119894 nonsense probably null
R3879:Nup210l UTSW 3 90185473 missense probably damaging 1.00
R3882:Nup210l UTSW 3 90124210 missense probably benign 0.19
R3953:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R4290:Nup210l UTSW 3 90207326 missense probably benign 0.00
R4328:Nup210l UTSW 3 90175835 splice site probably null
R4629:Nup210l UTSW 3 90167875 missense probably benign 0.21
R4629:Nup210l UTSW 3 90190874 nonsense probably null
R4897:Nup210l UTSW 3 90193071 missense probably damaging 1.00
R4906:Nup210l UTSW 3 90170030 missense probably benign 0.06
R4966:Nup210l UTSW 3 90106901 missense probably benign 0.00
R5004:Nup210l UTSW 3 90180165 nonsense probably null
R5237:Nup210l UTSW 3 90180198 missense probably benign 0.00
R5499:Nup210l UTSW 3 90174370 missense probably damaging 1.00
R5522:Nup210l UTSW 3 90154665 missense probably benign 0.10
R5627:Nup210l UTSW 3 90144250 missense probably damaging 0.97
R5678:Nup210l UTSW 3 90190959 missense probably damaging 0.99
R5726:Nup210l UTSW 3 90129207 splice site probably null
R5792:Nup210l UTSW 3 90199857 missense probably damaging 1.00
R6129:Nup210l UTSW 3 90104176 missense probably benign 0.00
R6272:Nup210l UTSW 3 90170024 missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90119909 nonsense probably null
R6293:Nup210l UTSW 3 90115064 missense probably damaging 1.00
R6446:Nup210l UTSW 3 90172068 missense probably damaging 1.00
R6698:Nup210l UTSW 3 90182508 missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90136924 missense probably benign 0.01
R6895:Nup210l UTSW 3 90159924 missense probably damaging 0.97
R6899:Nup210l UTSW 3 90167897 missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90154566 missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90119927 missense probably benign 0.04
R7038:Nup210l UTSW 3 90159947 missense probably damaging 1.00
R7273:Nup210l UTSW 3 90118547 missense probably benign 0.04
R7450:Nup210l UTSW 3 90115188 critical splice donor site probably null
R7514:Nup210l UTSW 3 90210459 critical splice donor site probably null
R7658:Nup210l UTSW 3 90211993 missense probably benign 0.43
R7735:Nup210l UTSW 3 90185576 missense probably damaging 1.00
R7772:Nup210l UTSW 3 90159926 missense probably damaging 1.00
R7800:Nup210l UTSW 3 90134597 missense probably damaging 1.00
R7840:Nup210l UTSW 3 90122729 missense probably benign 0.08
R7847:Nup210l UTSW 3 90151123 missense probably benign
R7848:Nup210l UTSW 3 90203905 missense probably benign 0.01
R8084:Nup210l UTSW 3 90136058 missense probably benign 0.15
R8121:Nup210l UTSW 3 90115121 missense probably damaging 1.00
R8421:Nup210l UTSW 3 90203867 missense probably damaging 1.00
R8458:Nup210l UTSW 3 90185567 missense probably null 1.00
R8701:Nup210l UTSW 3 90122814 missense probably benign 0.41
R8720:Nup210l UTSW 3 90210374 missense probably benign 0.00
R8770:Nup210l UTSW 3 90118543 missense probably damaging 1.00
R8896:Nup210l UTSW 3 90118625 missense probably damaging 1.00
R9033:Nup210l UTSW 3 90198089 missense probably benign
R9371:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9373:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9381:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9426:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9427:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9501:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9523:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9574:Nup210l UTSW 3 90210386 missense probably benign
R9612:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9654:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9660:Nup210l UTSW 3 90198095 missense probably benign 0.30
R9660:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9662:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9682:Nup210l UTSW 3 90144162 missense possibly damaging 0.79
R9750:Nup210l UTSW 3 90210352 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGCATGCACCCACATTCC -3'
(R):5'- AGGTATTTACTACTAAGCATAGCCA -3'

Sequencing Primer
(F):5'- CTGAGGACAGCTACAGTGTACTTAC -3'
(R):5'- CTGTGGAGAAACTCCTTACC -3'
Posted On 2022-10-06