Incidental Mutation 'R9729:Vmn2r51'
ID 731216
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Name vomeronasal 2, receptor 51
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R9729 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 9821125-9839586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 9839479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 36 (D36E)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
AlphaFold L7N215
Predicted Effect probably benign
Transcript: ENSMUST00000094863
AA Change: D36E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: D36E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A T 13: 54,700,519 (GRCm39) M273K probably benign Het
Aar2 A G 2: 156,393,361 (GRCm39) D250G probably benign Het
Acly T A 11: 100,407,711 (GRCm39) Y213F probably benign Het
Adgrg5 G A 8: 95,668,133 (GRCm39) M399I Het
Adhfe1 T C 1: 9,623,634 (GRCm39) L95P probably damaging Het
Ano7 G A 1: 93,322,180 (GRCm39) C396Y probably damaging Het
Apob T A 12: 8,066,125 (GRCm39) Y4365N probably damaging Het
Arfgap3 C T 15: 83,192,366 (GRCm39) R411H probably damaging Het
Bbs7 T C 3: 36,661,818 (GRCm39) Y127C probably damaging Het
Cadps2 T C 6: 23,382,982 (GRCm39) T793A probably benign Het
Casp8ap2 T A 4: 32,643,807 (GRCm39) V960E possibly damaging Het
Cd200l1 G T 16: 45,264,237 (GRCm39) T107N possibly damaging Het
Cdkl3 A G 11: 51,895,770 (GRCm39) T6A probably benign Het
Cdkn2aip T C 8: 48,166,654 (GRCm39) D51G probably benign Het
Cdpf1 G T 15: 85,692,527 (GRCm39) S52* probably null Het
Celf5 T A 10: 81,303,925 (GRCm39) D177V probably damaging Het
Cep164 A G 9: 45,682,897 (GRCm39) V931A probably damaging Het
Cog6 T C 3: 52,900,907 (GRCm39) D457G probably damaging Het
Col4a2 G T 8: 11,496,157 (GRCm39) V1593L probably benign Het
Dlg5 C G 14: 24,204,681 (GRCm39) M1287I probably benign Het
Dmrt1 T C 19: 25,523,362 (GRCm39) S238P probably benign Het
Dpysl2 A G 14: 67,099,927 (GRCm39) M103T probably benign Het
Emsy C A 7: 98,262,256 (GRCm39) A608S probably benign Het
Entr1 A G 2: 26,278,645 (GRCm39) F21S unknown Het
Entrep2 C T 7: 64,806,056 (GRCm39) G6S probably benign Het
Exoc5 A T 14: 49,253,086 (GRCm39) C576S probably damaging Het
F830016B08Rik G A 18: 60,433,558 (GRCm39) V214M possibly damaging Het
Fignl1 A G 11: 11,752,219 (GRCm39) S279P probably benign Het
Gimap1 A G 6: 48,719,386 (GRCm39) R71G unknown Het
Gm26727 A T 2: 67,263,263 (GRCm39) M88K probably damaging Het
Gm45861 T A 8: 28,045,436 (GRCm39) W1066R unknown Het
Gpr15 A G 16: 58,538,249 (GRCm39) L280S possibly damaging Het
Grin1 C T 2: 25,187,422 (GRCm39) W629* probably null Het
Grk5 C T 19: 61,078,467 (GRCm39) P508L possibly damaging Het
Hgf A T 5: 16,766,029 (GRCm39) D55V probably damaging Het
Hipk1 T A 3: 103,668,890 (GRCm39) D502V probably damaging Het
Kmt2c T C 5: 25,489,758 (GRCm39) K4394E probably damaging Het
Llgl2 A G 11: 115,740,467 (GRCm39) T388A probably damaging Het
Lsm14a G T 7: 34,088,898 (GRCm39) S2R probably damaging Het
Madd A T 2: 91,000,544 (GRCm39) M507K possibly damaging Het
Map2k3 G T 11: 60,837,472 (GRCm39) V191L Het
Mapk8ip1 A G 2: 92,217,060 (GRCm39) S421P probably damaging Het
Marchf7 C T 2: 60,064,785 (GRCm39) R354* probably null Het
Myc T G 15: 61,859,935 (GRCm39) C204G probably damaging Het
Nampt A G 12: 32,900,528 (GRCm39) H491R possibly damaging Het
Noct C T 3: 51,157,267 (GRCm39) Q202* probably null Het
Nup210l C T 3: 90,107,173 (GRCm39) P1570L probably benign Het
Or10b1 T A 10: 78,355,949 (GRCm39) F169Y probably damaging Het
Osbpl10 G A 9: 115,052,804 (GRCm39) V451M probably damaging Het
Osr2 T A 15: 35,303,061 (GRCm39) F312Y probably benign Het
Parp16 A T 9: 65,137,097 (GRCm39) I108F possibly damaging Het
Parp4 A G 14: 56,885,888 (GRCm39) T1656A unknown Het
Pnpla8 A G 12: 44,330,657 (GRCm39) I374V probably benign Het
Prss23 T C 7: 89,159,931 (GRCm39) N46S probably benign Het
Ptger2 T C 14: 45,226,476 (GRCm39) W19R possibly damaging Het
Rbl2 T C 8: 91,805,527 (GRCm39) S195P probably damaging Het
Rnf169 C T 7: 99,575,477 (GRCm39) V373I probably damaging Het
Sclt1 C A 3: 41,629,837 (GRCm39) E325* probably null Het
Sergef C T 7: 46,284,913 (GRCm39) S43N probably benign Het
Slc35f3 CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 8: 127,115,777 (GRCm39) probably benign Het
Slc3a2 T C 19: 8,685,370 (GRCm39) D472G probably damaging Het
Slc43a3 T C 2: 84,780,800 (GRCm39) F342L probably benign Het
Slc44a4 A T 17: 35,140,670 (GRCm39) I288F probably benign Het
Snupn T A 9: 56,877,915 (GRCm39) N151K possibly damaging Het
Srbd1 A T 17: 86,437,550 (GRCm39) D264E probably benign Het
Srpra A T 9: 35,125,569 (GRCm39) T378S probably benign Het
Stat4 A G 1: 52,141,762 (GRCm39) D613G possibly damaging Het
Sycp2l C T 13: 41,326,132 (GRCm39) P246L Het
Tcf20 T C 15: 82,736,037 (GRCm39) R1805G probably benign Het
Tob1 T A 11: 94,104,880 (GRCm39) F139I probably damaging Het
Traj9 A G 14: 54,446,871 (GRCm39) T8A unknown Het
Trank1 G T 9: 111,220,537 (GRCm39) D2425Y probably damaging Het
Ttn G A 2: 76,738,071 (GRCm39) S4202L unknown Het
Ttn A T 2: 76,577,267 (GRCm39) M24542K probably damaging Het
Vcam1 T C 3: 115,911,105 (GRCm39) Y431C probably damaging Het
Vcpkmt G A 12: 69,627,936 (GRCm39) R175C probably damaging Het
Vmn2r61 A G 7: 41,949,917 (GRCm39) E779G probably damaging Het
Zfp831 T C 2: 174,487,938 (GRCm39) L871P possibly damaging Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 9,836,341 (GRCm39) missense probably benign
IGL01574:Vmn2r51 APN 7 9,836,381 (GRCm39) missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 9,834,154 (GRCm39) missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 9,839,409 (GRCm39) missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 9,834,243 (GRCm39) missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 9,832,046 (GRCm39) splice site probably benign
IGL02834:Vmn2r51 APN 7 9,832,063 (GRCm39) nonsense probably null
R0617:Vmn2r51 UTSW 7 9,834,396 (GRCm39) missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 9,834,012 (GRCm39) missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 9,836,373 (GRCm39) missense possibly damaging 0.87
R1559:Vmn2r51 UTSW 7 9,836,372 (GRCm39) missense possibly damaging 0.58
R1598:Vmn2r51 UTSW 7 9,839,432 (GRCm39) missense probably benign
R1754:Vmn2r51 UTSW 7 9,833,873 (GRCm39) missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 9,832,091 (GRCm39) nonsense probably null
R1836:Vmn2r51 UTSW 7 9,832,090 (GRCm39) nonsense probably null
R3151:Vmn2r51 UTSW 7 9,833,968 (GRCm39) missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 9,836,341 (GRCm39) missense probably benign
R4933:Vmn2r51 UTSW 7 9,832,247 (GRCm39) missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 9,821,932 (GRCm39) missense probably benign
R5050:Vmn2r51 UTSW 7 9,834,349 (GRCm39) missense probably damaging 0.99
R5510:Vmn2r51 UTSW 7 9,836,545 (GRCm39) missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 9,826,128 (GRCm39) missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 9,839,558 (GRCm39) missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 9,821,921 (GRCm39) missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 9,832,164 (GRCm39) missense probably benign 0.00
R6370:Vmn2r51 UTSW 7 9,832,143 (GRCm39) missense probably damaging 1.00
R6471:Vmn2r51 UTSW 7 9,836,510 (GRCm39) missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 9,832,191 (GRCm39) missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 9,834,025 (GRCm39) missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 9,834,480 (GRCm39) missense probably null 1.00
R7246:Vmn2r51 UTSW 7 9,836,428 (GRCm39) missense probably benign 0.00
R8939:Vmn2r51 UTSW 7 9,833,953 (GRCm39) missense possibly damaging 0.85
R9154:Vmn2r51 UTSW 7 9,839,480 (GRCm39) missense probably damaging 0.96
R9428:Vmn2r51 UTSW 7 9,833,712 (GRCm39) critical splice donor site probably benign
R9451:Vmn2r51 UTSW 7 9,833,816 (GRCm39) missense probably damaging 1.00
R9767:Vmn2r51 UTSW 7 9,839,407 (GRCm39) missense probably benign 0.09
Z1176:Vmn2r51 UTSW 7 9,833,835 (GRCm39) missense probably benign 0.12
Z1176:Vmn2r51 UTSW 7 9,821,984 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GGACAGAAGACTCAAGAATTTGCC -3'
(R):5'- ATGCAATAAACCTCACCTTTGC -3'

Sequencing Primer
(F):5'- TGCCAAATCTTCATCCTCAGAG -3'
(R):5'- AGCTGGTAGAAATCTGATGTGC -3'
Posted On 2022-10-06