Incidental Mutation 'R9292:Dock8'
ID 731281
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms 1200017A24Rik, 5830472H07Rik, A130095G14Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R9292 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 24976898-25179796 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 25160995 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025831
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C T 5: 8,862,843 (GRCm39) T175I probably benign Het
Acat3 T C 17: 13,146,255 (GRCm39) T243A probably benign Het
Aebp1 C A 11: 5,815,260 (GRCm39) P264Q possibly damaging Het
Aldh1l1 T C 6: 90,568,867 (GRCm39) F723L probably damaging Het
Atp13a4 T A 16: 29,241,500 (GRCm39) I723F Het
Bop1 T C 15: 76,351,031 (GRCm39) T97A probably benign Het
Casq1 T C 1: 172,043,114 (GRCm39) Y194C probably damaging Het
Cep250 G A 2: 155,832,688 (GRCm39) E1538K probably damaging Het
Col12a1 A T 9: 79,585,805 (GRCm39) V1218E probably benign Het
Coq10b T A 1: 55,110,868 (GRCm39) M212K probably damaging Het
Dchs1 T C 7: 105,403,120 (GRCm39) T3141A probably damaging Het
Dnajc10 A G 2: 80,176,916 (GRCm39) T624A probably benign Het
Dsg1c T A 18: 20,416,775 (GRCm39) V892E probably damaging Het
Eif4g3 A G 4: 137,921,382 (GRCm39) R1370G possibly damaging Het
Elmo1 T G 13: 20,784,429 (GRCm39) probably null Het
Erc2 T A 14: 27,498,799 (GRCm39) I225N probably damaging Het
Ermp1 C A 19: 29,606,049 (GRCm39) V422L probably benign Het
Fam124b T A 1: 80,191,221 (GRCm39) H54L probably benign Het
Gabbr1 T G 17: 37,366,784 (GRCm39) I336S possibly damaging Het
Galk2 T C 2: 125,817,218 (GRCm39) Y336H probably damaging Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Grm4 A G 17: 27,692,037 (GRCm39) F194S probably damaging Het
Gtf2a1 G A 12: 91,534,964 (GRCm39) Q189* probably null Het
Gtf3c1 T C 7: 125,273,563 (GRCm39) probably benign Het
Hspa2 A G 12: 76,452,047 (GRCm39) E247G probably damaging Het
Lpar1 T C 4: 58,486,558 (GRCm39) R238G probably benign Het
Ltbp1 C A 17: 75,583,436 (GRCm39) S412Y probably damaging Het
Nup210 A C 6: 91,051,235 (GRCm39) S383A possibly damaging Het
Or10j3 C T 1: 173,031,099 (GRCm39) P59S probably damaging Het
Or11g2 T C 14: 50,856,513 (GRCm39) V278A possibly damaging Het
Or8b51 T A 9: 38,569,071 (GRCm39) N206Y probably damaging Het
Pah T A 10: 87,403,218 (GRCm39) Y198N probably damaging Het
Pcdhga4 A T 18: 37,819,713 (GRCm39) I421L probably benign Het
Pde6b T C 5: 108,536,751 (GRCm39) I149T probably benign Het
Peli3 G A 19: 4,988,117 (GRCm39) P81L possibly damaging Het
Pfdn5 T C 15: 102,234,883 (GRCm39) S30P possibly damaging Het
Plcb3 A T 19: 6,942,042 (GRCm39) L263Q probably damaging Het
Pld3 T C 7: 27,238,879 (GRCm39) M190V probably benign Het
Rab6a A G 7: 100,285,963 (GRCm39) E186G probably benign Het
Ralyl T A 3: 14,172,312 (GRCm39) D60E probably benign Het
Rtl1 G A 12: 109,556,673 (GRCm39) A1722V possibly damaging Het
Scarf1 T C 11: 75,406,006 (GRCm39) Y97H probably damaging Het
Sf3a2 T A 10: 80,640,560 (GRCm39) V457E unknown Het
Sh2d4b C G 14: 40,537,914 (GRCm39) E403Q probably damaging Het
Slc12a7 A G 13: 73,932,707 (GRCm39) E65G possibly damaging Het
Spink5 T C 18: 44,148,075 (GRCm39) V905A possibly damaging Het
Spred1 T C 2: 117,005,832 (GRCm39) F198S probably benign Het
St18 C A 1: 6,898,106 (GRCm39) T636K probably benign Het
Stag3 T A 5: 138,299,712 (GRCm39) D874E probably benign Het
Suco T C 1: 161,671,574 (GRCm39) T502A probably damaging Het
Swt1 T C 1: 151,278,787 (GRCm39) I457V probably benign Het
Syne2 G T 12: 75,997,823 (GRCm39) C2266F probably benign Het
Tcirg1 T C 19: 3,947,840 (GRCm39) N532D probably damaging Het
Tfdp1 T A 8: 13,420,580 (GRCm39) N136K probably benign Het
Tmem245 T C 4: 56,926,173 (GRCm39) probably benign Het
Tmem245 T C 4: 56,937,979 (GRCm39) I190V probably benign Het
Trp53bp1 C T 2: 121,046,177 (GRCm39) V1208M probably damaging Het
Tulp1 T A 17: 28,582,738 (GRCm39) K137* probably null Het
Zfp534 A T 4: 147,759,095 (GRCm39) C525S probably damaging Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25,105,076 (GRCm39) critical splice donor site probably benign
primurus APN 19 25,160,973 (GRCm39) missense probably damaging 1.00
IGL00737:Dock8 APN 19 25,160,340 (GRCm39) missense probably benign 0.00
IGL00755:Dock8 APN 19 25,028,873 (GRCm39) missense probably benign 0.09
IGL00822:Dock8 APN 19 25,165,773 (GRCm39) nonsense probably null
IGL00838:Dock8 APN 19 25,152,823 (GRCm39) nonsense probably null
IGL01419:Dock8 APN 19 25,096,816 (GRCm39) missense probably benign 0.08
IGL01456:Dock8 APN 19 25,096,863 (GRCm39) missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25,146,805 (GRCm39) missense probably damaging 0.99
IGL01602:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01605:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01753:Dock8 APN 19 25,038,656 (GRCm39) splice site probably benign
IGL01843:Dock8 APN 19 25,067,292 (GRCm39) missense probably benign 0.02
IGL02032:Dock8 APN 19 25,107,769 (GRCm39) missense probably damaging 0.99
IGL02073:Dock8 APN 19 25,178,350 (GRCm39) critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25,055,569 (GRCm39) critical splice donor site probably null
IGL02402:Dock8 APN 19 25,055,509 (GRCm39) missense probably benign 0.25
IGL02529:Dock8 APN 19 25,078,290 (GRCm39) nonsense probably null
IGL02728:Dock8 APN 19 25,109,584 (GRCm39) missense probably benign
IGL02739:Dock8 APN 19 25,165,852 (GRCm39) missense probably damaging 1.00
IGL03037:Dock8 APN 19 25,063,545 (GRCm39) missense probably benign 0.02
IGL03104:Dock8 APN 19 25,178,384 (GRCm39) nonsense probably null
IGL03137:Dock8 APN 19 25,133,312 (GRCm39) missense probably benign 0.19
IGL03365:Dock8 APN 19 25,077,048 (GRCm39) missense possibly damaging 0.70
Defenseless UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
Guardate UTSW 19 25,127,195 (GRCm39) missense probably benign
hillock UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
Molehill UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
Pap UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
Papilla UTSW 19 25,055,448 (GRCm39) nonsense probably null
snowdrop UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
warts_and_all UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R0021:Dock8 UTSW 19 25,140,411 (GRCm39) missense probably benign 0.01
R0147:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0148:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0294:Dock8 UTSW 19 25,165,714 (GRCm39) missense probably damaging 1.00
R0537:Dock8 UTSW 19 25,148,941 (GRCm39) missense probably benign 0.08
R0630:Dock8 UTSW 19 25,038,524 (GRCm39) missense probably benign 0.10
R1163:Dock8 UTSW 19 25,028,867 (GRCm39) missense probably benign
R1164:Dock8 UTSW 19 25,067,391 (GRCm39) missense probably benign 0.44
R1471:Dock8 UTSW 19 25,178,400 (GRCm39) missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
R1803:Dock8 UTSW 19 25,109,599 (GRCm39) missense probably benign 0.00
R1822:Dock8 UTSW 19 25,138,422 (GRCm39) missense probably benign 0.31
R1852:Dock8 UTSW 19 25,104,492 (GRCm39) missense probably benign 0.45
R1916:Dock8 UTSW 19 25,038,521 (GRCm39) missense probably benign 0.02
R1984:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R2311:Dock8 UTSW 19 25,160,368 (GRCm39) missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25,177,757 (GRCm39) missense probably damaging 0.99
R2483:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3116:Dock8 UTSW 19 25,165,858 (GRCm39) missense probably benign 0.00
R3157:Dock8 UTSW 19 25,127,195 (GRCm39) missense probably benign
R3623:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3624:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3800:Dock8 UTSW 19 25,141,716 (GRCm39) missense probably benign 0.08
R3844:Dock8 UTSW 19 25,042,794 (GRCm39) nonsense probably null
R3895:Dock8 UTSW 19 25,028,865 (GRCm39) missense probably benign 0.31
R3901:Dock8 UTSW 19 25,078,269 (GRCm39) missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
R4428:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4428:Dock8 UTSW 19 25,177,863 (GRCm39) missense probably damaging 0.98
R4429:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4431:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4545:Dock8 UTSW 19 25,165,722 (GRCm39) missense probably damaging 1.00
R4839:Dock8 UTSW 19 25,146,858 (GRCm39) missense probably benign 0.00
R4897:Dock8 UTSW 19 25,159,001 (GRCm39) missense probably benign 0.00
R4939:Dock8 UTSW 19 25,099,764 (GRCm39) missense probably damaging 1.00
R4995:Dock8 UTSW 19 25,135,747 (GRCm39) missense probably benign 0.02
R5035:Dock8 UTSW 19 25,063,571 (GRCm39) missense probably damaging 0.99
R5294:Dock8 UTSW 19 25,038,517 (GRCm39) missense probably benign 0.01
R5324:Dock8 UTSW 19 25,140,458 (GRCm39) missense probably benign 0.17
R5478:Dock8 UTSW 19 25,057,186 (GRCm39) missense probably benign
R5704:Dock8 UTSW 19 25,151,586 (GRCm39) missense probably damaging 1.00
R5724:Dock8 UTSW 19 25,099,785 (GRCm39) missense probably damaging 1.00
R5745:Dock8 UTSW 19 25,107,761 (GRCm39) missense probably benign 0.02
R5864:Dock8 UTSW 19 25,038,584 (GRCm39) missense probably damaging 0.99
R5870:Dock8 UTSW 19 25,109,490 (GRCm39) missense probably benign
R5893:Dock8 UTSW 19 25,099,811 (GRCm39) missense probably damaging 1.00
R5954:Dock8 UTSW 19 25,148,983 (GRCm39) missense probably damaging 1.00
R6087:Dock8 UTSW 19 25,138,438 (GRCm39) missense probably benign 0.00
R6223:Dock8 UTSW 19 25,138,416 (GRCm39) missense probably benign 0.00
R6391:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25,104,848 (GRCm39) missense probably damaging 0.99
R6786:Dock8 UTSW 19 25,160,386 (GRCm39) missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
R6818:Dock8 UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R6885:Dock8 UTSW 19 25,124,742 (GRCm39) missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25,165,746 (GRCm39) missense probably damaging 1.00
R6923:Dock8 UTSW 19 25,072,970 (GRCm39) missense probably benign
R7001:Dock8 UTSW 19 25,077,041 (GRCm39) missense probably benign
R7141:Dock8 UTSW 19 25,158,984 (GRCm39) missense probably null 0.75
R7203:Dock8 UTSW 19 25,158,927 (GRCm39) missense probably damaging 1.00
R7257:Dock8 UTSW 19 25,104,449 (GRCm39) missense probably benign 0.08
R7296:Dock8 UTSW 19 25,162,245 (GRCm39) missense probably benign 0.00
R7538:Dock8 UTSW 19 25,135,782 (GRCm39) missense probably damaging 1.00
R7555:Dock8 UTSW 19 25,152,764 (GRCm39) missense probably damaging 0.99
R7641:Dock8 UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
R7764:Dock8 UTSW 19 25,074,899 (GRCm39) missense probably benign
R7859:Dock8 UTSW 19 25,160,934 (GRCm39) missense probably damaging 1.00
R7864:Dock8 UTSW 19 25,140,864 (GRCm39) missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25,131,606 (GRCm39) missense probably damaging 1.00
R8160:Dock8 UTSW 19 25,124,711 (GRCm39) missense probably damaging 1.00
R8287:Dock8 UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
R8295:Dock8 UTSW 19 25,100,600 (GRCm39) missense probably benign 0.04
R8443:Dock8 UTSW 19 25,133,281 (GRCm39) missense probably benign 0.04
R8537:Dock8 UTSW 19 25,107,870 (GRCm39) missense probably benign 0.00
R8673:Dock8 UTSW 19 25,160,867 (GRCm39) missense probably damaging 0.96
R8709:Dock8 UTSW 19 25,055,448 (GRCm39) nonsense probably null
R8834:Dock8 UTSW 19 25,140,834 (GRCm39) missense probably benign 0.16
R8991:Dock8 UTSW 19 25,165,731 (GRCm39) missense possibly damaging 0.82
R9509:Dock8 UTSW 19 25,072,985 (GRCm39) missense probably benign 0.00
R9526:Dock8 UTSW 19 25,165,739 (GRCm39) missense probably benign 0.10
R9622:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R9634:Dock8 UTSW 19 25,169,585 (GRCm39) missense probably damaging 1.00
R9654:Dock8 UTSW 19 25,124,710 (GRCm39) missense probably damaging 1.00
R9670:Dock8 UTSW 19 25,148,926 (GRCm39) missense probably null 0.01
R9699:Dock8 UTSW 19 25,133,388 (GRCm39) critical splice donor site probably null
R9726:Dock8 UTSW 19 25,154,374 (GRCm39) missense probably damaging 0.97
R9765:Dock8 UTSW 19 25,146,832 (GRCm39) missense possibly damaging 0.94
X0027:Dock8 UTSW 19 25,138,493 (GRCm39) missense probably benign
Z1177:Dock8 UTSW 19 25,133,336 (GRCm39) missense probably benign 0.16
Z1177:Dock8 UTSW 19 25,109,487 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AACCAGTCCTTTTAGCCCAG -3'
(R):5'- CTCTGTAAAACGCACACAGG -3'

Sequencing Primer
(F):5'- TAAGCACAGCTAAAGGAGGCTTCTC -3'
(R):5'- GAGGCCAGCAATGAACAT -3'
Posted On 2022-10-10