Incidental Mutation 'R9442:Ntn1'
ID 731305
Institutional Source Beutler Lab
Gene Symbol Ntn1
Ensembl Gene ENSMUSG00000020902
Gene Name netrin 1
Synonyms Netrin-1
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.735) question?
Stock # R9442 (G1)
Quality Score 82.0076
Status Validated
Chromosome 11
Chromosomal Location 68100190-68277652 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to C at 68148485 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021284] [ENSMUST00000108674]
AlphaFold O09118
Predicted Effect probably benign
Transcript: ENSMUST00000021284
SMART Domains Protein: ENSMUSP00000021284
Gene: ENSMUSG00000020902

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108674
SMART Domains Protein: ENSMUSP00000104314
Gene: ENSMUSG00000020902

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit impaired axonal migration, abnormal semicircular canals, lack of corpus callosum, aberrant commissures, hypoplasia of the optic nerve, motor and balance defects, failure to suckle, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T A 17: 48,347,580 (GRCm39) K241N possibly damaging Het
Adam5 A T 8: 25,296,510 (GRCm39) S312R probably damaging Het
Atg9a C T 1: 75,163,086 (GRCm39) C338Y possibly damaging Het
Cage1 T C 13: 38,196,447 (GRCm39) E749G possibly damaging Het
Catspere2 C A 1: 177,931,275 (GRCm39) T398K unknown Het
Ccdc88b T C 19: 6,833,213 (GRCm39) E278G probably damaging Het
Ccndbp1 T C 2: 120,839,013 (GRCm39) V8A probably benign Het
Cenpt T C 8: 106,575,418 (GRCm39) D228G probably benign Het
Cfap57 A G 4: 118,463,731 (GRCm39) probably null Het
Cyp4a32 T A 4: 115,468,422 (GRCm39) N301K probably benign Het
Epha6 T C 16: 60,025,850 (GRCm39) T531A probably benign Het
Gmeb1 A T 4: 131,962,156 (GRCm39) C168S probably damaging Het
H2-DMa G A 17: 34,357,132 (GRCm39) R210H possibly damaging Het
Ighv1-7 T G 12: 114,502,198 (GRCm39) T90P probably damaging Het
Kalrn A C 16: 33,916,249 (GRCm39) M1R probably null Het
Kcnrg CACAACAA CACAA 14: 61,845,009 (GRCm39) probably benign Het
Krtap14 T C 16: 88,622,865 (GRCm39) D38G possibly damaging Het
Lrrc8e A G 8: 4,283,964 (GRCm39) N63S probably benign Het
Map4k2 T A 19: 6,392,814 (GRCm39) L152Q probably damaging Het
Mcf2l A G 8: 13,023,048 (GRCm39) D78G possibly damaging Het
Ms4a6c T C 19: 11,449,851 (GRCm39) V81A probably benign Het
Mtnr1b T C 9: 15,785,660 (GRCm39) T33A probably benign Het
Muc16 T A 9: 18,566,624 (GRCm39) Q1965L unknown Het
Nfatc2 A C 2: 168,328,898 (GRCm39) probably benign Het
Nlrp9b C T 7: 19,779,707 (GRCm39) T790I possibly damaging Het
Nol4 A T 18: 22,902,899 (GRCm39) C371S probably damaging Het
Or14j3 A G 17: 37,900,633 (GRCm39) S204P possibly damaging Het
Orc1 T C 4: 108,469,357 (GRCm39) V727A probably benign Het
Phf20l1 C T 15: 66,484,888 (GRCm39) Q318* probably null Het
Psg18 A T 7: 18,083,185 (GRCm39) Y323* probably null Het
Ptk2b T C 14: 66,409,189 (GRCm39) Y529C probably damaging Het
Rrm1 A G 7: 102,108,598 (GRCm39) Y374C probably damaging Het
Selp T A 1: 163,964,765 (GRCm39) F476I probably damaging Het
Sema3b A G 9: 107,478,957 (GRCm39) probably null Het
Setdb2 T G 14: 59,639,849 (GRCm39) T665P probably damaging Het
Sorbs3 T C 14: 70,424,387 (GRCm39) Y515C probably damaging Het
St13 G A 15: 81,272,575 (GRCm39) P90S possibly damaging Het
Stag1 T A 9: 100,836,306 (GRCm39) I1197N probably damaging Het
Svs3a A G 2: 164,132,179 (GRCm39) Y250C probably damaging Het
Ticam1 T C 17: 56,577,428 (GRCm39) I556V probably benign Het
Vmn1r180 A G 7: 23,651,620 (GRCm39) probably benign Het
Xirp2 T A 2: 67,342,235 (GRCm39) L1492* probably null Het
Zfp438 A G 18: 5,214,379 (GRCm39) V193A probably benign Het
Zfp729b A G 13: 67,739,337 (GRCm39) V976A probably benign Het
Other mutations in Ntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ntn1 APN 11 68,117,445 (GRCm39) splice site probably benign
IGL00972:Ntn1 APN 11 68,104,098 (GRCm39) missense possibly damaging 0.83
IGL01695:Ntn1 APN 11 68,117,430 (GRCm39) missense probably benign 0.00
IGL01731:Ntn1 APN 11 68,276,244 (GRCm39) missense probably damaging 1.00
IGL02008:Ntn1 APN 11 68,104,089 (GRCm39) missense probably damaging 1.00
IGL02584:Ntn1 APN 11 68,168,356 (GRCm39) missense probably damaging 1.00
IGL02664:Ntn1 APN 11 68,276,295 (GRCm39) missense probably benign 0.06
R0363:Ntn1 UTSW 11 68,276,369 (GRCm39) missense probably benign 0.44
R1201:Ntn1 UTSW 11 68,104,052 (GRCm39) missense probably damaging 0.96
R1268:Ntn1 UTSW 11 68,103,959 (GRCm39) small deletion probably benign
R1913:Ntn1 UTSW 11 68,104,011 (GRCm39) missense probably damaging 1.00
R2245:Ntn1 UTSW 11 68,276,120 (GRCm39) missense probably benign 0.12
R2248:Ntn1 UTSW 11 68,168,398 (GRCm39) missense possibly damaging 0.95
R2359:Ntn1 UTSW 11 68,276,438 (GRCm39) missense probably damaging 1.00
R2862:Ntn1 UTSW 11 68,276,690 (GRCm39) missense probably benign 0.00
R3830:Ntn1 UTSW 11 68,276,619 (GRCm39) missense probably damaging 1.00
R3851:Ntn1 UTSW 11 68,276,619 (GRCm39) missense probably damaging 1.00
R3852:Ntn1 UTSW 11 68,276,619 (GRCm39) missense probably damaging 1.00
R4413:Ntn1 UTSW 11 68,276,736 (GRCm39) missense probably damaging 1.00
R4870:Ntn1 UTSW 11 68,103,852 (GRCm39) small deletion probably benign
R4871:Ntn1 UTSW 11 68,103,852 (GRCm39) small deletion probably benign
R4952:Ntn1 UTSW 11 68,103,852 (GRCm39) small deletion probably benign
R5001:Ntn1 UTSW 11 68,151,358 (GRCm39) missense probably damaging 1.00
R5279:Ntn1 UTSW 11 68,276,538 (GRCm39) missense probably benign 0.37
R6217:Ntn1 UTSW 11 68,104,158 (GRCm39) missense possibly damaging 0.91
R6505:Ntn1 UTSW 11 68,104,025 (GRCm39) missense probably damaging 1.00
R6669:Ntn1 UTSW 11 68,276,576 (GRCm39) missense probably benign 0.00
R7172:Ntn1 UTSW 11 68,276,493 (GRCm39) missense probably damaging 1.00
R7411:Ntn1 UTSW 11 68,276,915 (GRCm39) missense probably benign 0.15
R8314:Ntn1 UTSW 11 68,276,450 (GRCm39) missense probably damaging 1.00
R9216:Ntn1 UTSW 11 68,117,397 (GRCm39) missense possibly damaging 0.76
R9385:Ntn1 UTSW 11 68,276,013 (GRCm39) missense probably damaging 1.00
R9697:Ntn1 UTSW 11 68,168,356 (GRCm39) missense probably damaging 1.00
R9752:Ntn1 UTSW 11 68,276,712 (GRCm39) missense possibly damaging 0.80
X0027:Ntn1 UTSW 11 68,276,462 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGGGGATTGATTGTCTCACC -3'
(R):5'- ACAAGATCAGCCCTGAGGAC -3'

Sequencing Primer
(F):5'- GGATTGATTGTCTCACCTTCCGG -3'
(R):5'- GCCCTGAGGACCGCCAG -3'
Posted On 2022-10-19