Incidental Mutation 'R9116:Ube3b'
ID 731313
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9116 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 114380607-114421169 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) C to T at 114404776 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect probably benign
Transcript: ENSMUST00000074002
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,003,139 L689Q Het
Abcc2 G A 19: 43,804,952 V348M probably benign Het
Abhd5 T C 9: 122,367,927 S60P probably benign Het
Adamts10 C A 17: 33,537,356 H324Q probably benign Het
Akap1 A G 11: 88,832,339 L823P probably damaging Het
Aoc1 G A 6: 48,908,588 V676I probably damaging Het
Arhgef12 T C 9: 42,981,945 probably benign Het
Arl4d A C 11: 101,666,794 S49R possibly damaging Het
Atr A G 9: 95,865,798 I378V probably benign Het
Bicd1 G A 6: 149,484,176 V136I probably benign Het
Brd1 A T 15: 88,701,171 L820H possibly damaging Het
Cd163l1 A G 7: 140,228,364 T754A probably benign Het
Cfap70 T C 14: 20,447,522 T55A probably benign Het
Cog7 G T 7: 121,971,338 N182K probably damaging Het
Col4a4 T A 1: 82,454,031 T1511S unknown Het
Cr2 A T 1: 195,158,669 Y438* probably null Het
Ctnnbl1 T A 2: 157,806,703 V198E probably damaging Het
Fam117b C T 1: 59,979,297 Q58* probably null Het
Fam171a2 A G 11: 102,439,693 Y288H probably damaging Het
Fam186a A T 15: 99,942,591 I1924K possibly damaging Het
Fancd2 A G 6: 113,555,219 I498V probably benign Het
Fat3 T A 9: 15,998,125 I2194F probably benign Het
Flg2 T C 3: 93,202,284 S540P unknown Het
Gbp9 T C 5: 105,083,829 Y297C Het
Gck T G 11: 5,904,377 N283H possibly damaging Het
Gm13941 A T 2: 111,104,801 L28Q unknown Het
Gm9833 G A 3: 10,088,533 V121M probably damaging Het
Gpr155 A G 2: 73,373,765 I235T possibly damaging Het
Junb A C 8: 84,977,423 L336R probably damaging Het
Krt14 A T 11: 100,205,078 M218K probably benign Het
Leprotl1 A G 8: 34,137,813 V102A probably benign Het
Lrrc8d T C 5: 105,814,042 F773L probably damaging Het
Mad2l1bp G A 17: 46,148,032 R191C probably damaging Het
Man1c1 C T 4: 134,584,394 V274M possibly damaging Het
Mtor C A 4: 148,552,741 P2466T probably benign Het
Mycbpap C A 11: 94,507,206 probably benign Het
Myo18b T C 5: 112,827,996 E1329G probably damaging Het
Nipbl A T 15: 8,350,856 D817E probably benign Het
Nthl1 C T 17: 24,634,779 Q133* probably null Het
Nup133 A G 8: 123,933,416 M381T probably benign Het
Olfr137 T C 17: 38,304,763 T233A probably benign Het
Olfr155 T C 4: 43,854,602 C98R probably damaging Het
Olfr574 T C 7: 102,949,320 I285T possibly damaging Het
Olfr835 T C 9: 19,035,477 M118T probably damaging Het
Olfr869 T C 9: 20,137,337 Y74H probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pmm1 C T 15: 81,955,695 R143H probably damaging Het
Pmpcb A T 5: 21,756,610 I422F probably damaging Het
Prpf8 T A 11: 75,489,763 H97Q possibly damaging Het
Psat1 A G 19: 15,920,968 L30P probably damaging Het
Rag1 T C 2: 101,642,475 D774G probably damaging Het
Rag1 C T 2: 101,644,792 A2T probably benign Het
Rccd1 G T 7: 80,320,980 F17L probably damaging Het
Rhobtb1 T A 10: 69,270,749 D443E probably damaging Het
Rnf13 A G 3: 57,802,445 probably null Het
Ryr2 A G 13: 11,572,299 S4699P possibly damaging Het
Sdc3 T C 4: 130,819,041 V237A probably benign Het
Serinc5 T A 13: 92,661,006 probably benign Het
Sertad4 A G 1: 192,846,665 I281T probably benign Het
Shroom1 T C 11: 53,463,663 S137P probably damaging Het
Slurp1 C T 15: 74,727,601 G20D probably damaging Het
Sncb T A 13: 54,762,699 N75Y probably damaging Het
Spag8 C T 4: 43,653,231 G77S unknown Het
Spink14 A T 18: 44,030,992 I76F probably damaging Het
Srfbp1 A T 18: 52,490,030 E372D possibly damaging Het
Synpo A T 18: 60,602,527 N782K probably damaging Het
Syt7 T C 19: 10,444,009 M519T probably damaging Het
Tlr5 C T 1: 182,974,595 P488L probably benign Het
Tmod3 A T 9: 75,504,920 I315N probably damaging Het
Ttc12 T C 9: 49,453,457 M340V probably benign Het
Ttn T A 2: 76,880,615 I8392F unknown Het
Ttn A G 2: 76,938,888 V2822A unknown Het
Ubr4 C A 4: 139,418,474 N238K Het
Vmn2r12 T C 5: 109,086,019 T776A probably damaging Het
Vps50 G A 6: 3,588,091 probably benign Het
Vwa3a A G 7: 120,767,247 D165G Het
Wdr17 T A 8: 54,661,570 H644L probably damaging Het
Zfp628 T C 7: 4,921,203 V808A probably benign Het
Zscan21 T A 5: 138,125,675 D205E probably damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114415287 missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114406252 missense probably null 0.86
IGL02632:Ube3b APN 5 114398841 missense probably benign
IGL02850:Ube3b APN 5 114406249 missense probably damaging 1.00
IGL02878:Ube3b APN 5 114404717 splice site probably null
IGL02881:Ube3b APN 5 114412884 missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114398851 missense probably benign 0.17
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0111:Ube3b UTSW 5 114390376 splice site probably benign
R0309:Ube3b UTSW 5 114419469 splice site probably benign
R0718:Ube3b UTSW 5 114402555 nonsense probably null
R1344:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1350:Ube3b UTSW 5 114406137 splice site probably null
R1418:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1732:Ube3b UTSW 5 114387445 missense probably benign 0.01
R1764:Ube3b UTSW 5 114404617 missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114399865 missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2015:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2041:Ube3b UTSW 5 114387233 missense probably damaging 0.99
R2074:Ube3b UTSW 5 114415255 missense probably benign 0.14
R2202:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R2205:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R3826:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3829:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3830:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3927:Ube3b UTSW 5 114415680 missense probably benign 0.03
R3974:Ube3b UTSW 5 114412430 missense probably benign 0.05
R4049:Ube3b UTSW 5 114412870 missense probably benign 0.09
R4096:Ube3b UTSW 5 114393086 missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114398428 missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114412444 missense probably damaging 1.00
R4688:Ube3b UTSW 5 114393078 missense probably benign 0.03
R4779:Ube3b UTSW 5 114404717 splice site probably null
R4824:Ube3b UTSW 5 114415726 splice site probably null
R4868:Ube3b UTSW 5 114398427 missense probably benign 0.00
R4953:Ube3b UTSW 5 114401410 missense probably benign 0.01
R5013:Ube3b UTSW 5 114407641 missense probably damaging 1.00
R5057:Ube3b UTSW 5 114406257 missense probably benign 0.01
R5117:Ube3b UTSW 5 114419631 missense probably damaging 0.96
R5131:Ube3b UTSW 5 114407546 missense probably damaging 1.00
R5498:Ube3b UTSW 5 114418574 missense probably damaging 1.00
R5564:Ube3b UTSW 5 114389075 missense probably damaging 1.00
R5572:Ube3b UTSW 5 114406179 missense probably damaging 0.99
R5580:Ube3b UTSW 5 114415323 missense probably benign
R5596:Ube3b UTSW 5 114406160 splice site probably null
R5843:Ube3b UTSW 5 114412299 missense probably damaging 1.00
R5910:Ube3b UTSW 5 114415309 missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114408124 missense probably benign 0.00
R6691:Ube3b UTSW 5 114408124 missense probably benign 0.00
R7148:Ube3b UTSW 5 114406252 missense probably damaging 0.97
R7334:Ube3b UTSW 5 114415681 missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114415284 missense possibly damaging 0.79
R7438:Ube3b UTSW 5 114418626 missense probably damaging 1.00
R7640:Ube3b UTSW 5 114415323 missense probably benign
R7825:Ube3b UTSW 5 114401312 missense probably damaging 1.00
R7958:Ube3b UTSW 5 114401423 missense probably benign 0.05
R8025:Ube3b UTSW 5 114408209 missense probably damaging 0.99
R8058:Ube3b UTSW 5 114406785 missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114412489 critical splice donor site probably null
R8182:Ube3b UTSW 5 114392138 missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114402686 missense probably benign 0.04
R8465:Ube3b UTSW 5 114390390 missense probably damaging 1.00
R8682:Ube3b UTSW 5 114412290 missense probably damaging 1.00
R8708:Ube3b UTSW 5 114393090 missense probably benign 0.34
R8758:Ube3b UTSW 5 114415200 critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114388739 missense probably damaging 1.00
R9058:Ube3b UTSW 5 114415239 missense probably benign 0.05
R9072:Ube3b UTSW 5 114404546 missense probably damaging 0.98
R9537:Ube3b UTSW 5 114387184 missense probably damaging 1.00
R9596:Ube3b UTSW 5 114389110 missense probably damaging 1.00
R9632:Ube3b UTSW 5 114415309 missense probably benign 0.00
R9710:Ube3b UTSW 5 114415309 missense probably benign 0.00
X0017:Ube3b UTSW 5 114415585 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CTTACGTACCTGGATGACCTGC -3'
(R):5'- GTGCCACATGCTTTCTGAATG -3'

Sequencing Primer
(F):5'- TGGATGACCTGCTGCCCAAG -3'
(R):5'- ACATGCTTTCTGAATGTCTTCTTG -3'
Posted On 2022-10-21