Mutagenetix > Incidental Mutation

Incidental Mutation 'R9116:Ube3b'

731313

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9116 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to T at 114404776 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]

AlphaFold

Q9ES34

Predicted Effect

probably benign
Transcript: ENSMUST00000074002

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130169

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196651

SMART Domains

Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
HECTc	122	495	1.1e-112	SMART

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	A	10: 80,003,139	L689Q		Het
Abcc2	G	A	19: 43,804,952	V348M	probably benign	Het
Abhd5	T	C	9: 122,367,927	S60P	probably benign	Het
Adamts10	C	A	17: 33,537,356	H324Q	probably benign	Het
Akap1	A	G	11: 88,832,339	L823P	probably damaging	Het
Aoc1	G	A	6: 48,908,588	V676I	probably damaging	Het
Arhgef12	T	C	9: 42,981,945		probably benign	Het
Arl4d	A	C	11: 101,666,794	S49R	possibly damaging	Het
Atr	A	G	9: 95,865,798	I378V	probably benign	Het
Bicd1	G	A	6: 149,484,176	V136I	probably benign	Het
Brd1	A	T	15: 88,701,171	L820H	possibly damaging	Het
Cd163l1	A	G	7: 140,228,364	T754A	probably benign	Het
Cfap70	T	C	14: 20,447,522	T55A	probably benign	Het
Cog7	G	T	7: 121,971,338	N182K	probably damaging	Het
Col4a4	T	A	1: 82,454,031	T1511S	unknown	Het
Cr2	A	T	1: 195,158,669	Y438*	probably null	Het
Ctnnbl1	T	A	2: 157,806,703	V198E	probably damaging	Het
Fam117b	C	T	1: 59,979,297	Q58*	probably null	Het
Fam171a2	A	G	11: 102,439,693	Y288H	probably damaging	Het
Fam186a	A	T	15: 99,942,591	I1924K	possibly damaging	Het
Fancd2	A	G	6: 113,555,219	I498V	probably benign	Het
Fat3	T	A	9: 15,998,125	I2194F	probably benign	Het
Flg2	T	C	3: 93,202,284	S540P	unknown	Het
Gbp9	T	C	5: 105,083,829	Y297C		Het
Gck	T	G	11: 5,904,377	N283H	possibly damaging	Het
Gm13941	A	T	2: 111,104,801	L28Q	unknown	Het
Gm9833	G	A	3: 10,088,533	V121M	probably damaging	Het
Gpr155	A	G	2: 73,373,765	I235T	possibly damaging	Het
Junb	A	C	8: 84,977,423	L336R	probably damaging	Het
Krt14	A	T	11: 100,205,078	M218K	probably benign	Het
Leprotl1	A	G	8: 34,137,813	V102A	probably benign	Het
Lrrc8d	T	C	5: 105,814,042	F773L	probably damaging	Het
Mad2l1bp	G	A	17: 46,148,032	R191C	probably damaging	Het
Man1c1	C	T	4: 134,584,394	V274M	possibly damaging	Het
Mtor	C	A	4: 148,552,741	P2466T	probably benign	Het
Mycbpap	C	A	11: 94,507,206		probably benign	Het
Myo18b	T	C	5: 112,827,996	E1329G	probably damaging	Het
Nipbl	A	T	15: 8,350,856	D817E	probably benign	Het
Nthl1	C	T	17: 24,634,779	Q133*	probably null	Het
Nup133	A	G	8: 123,933,416	M381T	probably benign	Het
Olfr137	T	C	17: 38,304,763	T233A	probably benign	Het
Olfr155	T	C	4: 43,854,602	C98R	probably damaging	Het
Olfr574	T	C	7: 102,949,320	I285T	possibly damaging	Het
Olfr835	T	C	9: 19,035,477	M118T	probably damaging	Het
Olfr869	T	C	9: 20,137,337	Y74H	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Pmm1	C	T	15: 81,955,695	R143H	probably damaging	Het
Pmpcb	A	T	5: 21,756,610	I422F	probably damaging	Het
Prpf8	T	A	11: 75,489,763	H97Q	possibly damaging	Het
Psat1	A	G	19: 15,920,968	L30P	probably damaging	Het
Rag1	T	C	2: 101,642,475	D774G	probably damaging	Het
Rag1	C	T	2: 101,644,792	A2T	probably benign	Het
Rccd1	G	T	7: 80,320,980	F17L	probably damaging	Het
Rhobtb1	T	A	10: 69,270,749	D443E	probably damaging	Het
Rnf13	A	G	3: 57,802,445		probably null	Het
Ryr2	A	G	13: 11,572,299	S4699P	possibly damaging	Het
Sdc3	T	C	4: 130,819,041	V237A	probably benign	Het
Serinc5	T	A	13: 92,661,006		probably benign	Het
Sertad4	A	G	1: 192,846,665	I281T	probably benign	Het
Shroom1	T	C	11: 53,463,663	S137P	probably damaging	Het
Slurp1	C	T	15: 74,727,601	G20D	probably damaging	Het
Sncb	T	A	13: 54,762,699	N75Y	probably damaging	Het
Spag8	C	T	4: 43,653,231	G77S	unknown	Het
Spink14	A	T	18: 44,030,992	I76F	probably damaging	Het
Srfbp1	A	T	18: 52,490,030	E372D	possibly damaging	Het
Synpo	A	T	18: 60,602,527	N782K	probably damaging	Het
Syt7	T	C	19: 10,444,009	M519T	probably damaging	Het
Tlr5	C	T	1: 182,974,595	P488L	probably benign	Het
Tmod3	A	T	9: 75,504,920	I315N	probably damaging	Het
Ttc12	T	C	9: 49,453,457	M340V	probably benign	Het
Ttn	T	A	2: 76,880,615	I8392F	unknown	Het
Ttn	A	G	2: 76,938,888	V2822A	unknown	Het
Ubr4	C	A	4: 139,418,474	N238K		Het
Vmn2r12	T	C	5: 109,086,019	T776A	probably damaging	Het
Vps50	G	A	6: 3,588,091		probably benign	Het
Vwa3a	A	G	7: 120,767,247	D165G		Het
Wdr17	T	A	8: 54,661,570	H644L	probably damaging	Het
Zfp628	T	C	7: 4,921,203	V808A	probably benign	Het
Zscan21	T	A	5: 138,125,675	D205E	probably damaging	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	splice site	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	splice site	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
R7640:Ube3b	UTSW	5	114415323	missense	probably benign
R7825:Ube3b	UTSW	5	114401312	missense	probably damaging	1.00
R7958:Ube3b	UTSW	5	114401423	missense	probably benign	0.05
R8025:Ube3b	UTSW	5	114408209	missense	probably damaging	0.99
R8058:Ube3b	UTSW	5	114406785	missense	possibly damaging	0.58
R8087:Ube3b	UTSW	5	114412489	critical splice donor site	probably null
R8182:Ube3b	UTSW	5	114392138	missense	possibly damaging	0.77
R8322:Ube3b	UTSW	5	114402686	missense	probably benign	0.04
R8465:Ube3b	UTSW	5	114390390	missense	probably damaging	1.00
R8682:Ube3b	UTSW	5	114412290	missense	probably damaging	1.00
R8708:Ube3b	UTSW	5	114393090	missense	probably benign	0.34
R8758:Ube3b	UTSW	5	114415200	critical splice acceptor site	probably benign
R8784:Ube3b	UTSW	5	114388739	missense	probably damaging	1.00
R9058:Ube3b	UTSW	5	114415239	missense	probably benign	0.05
R9072:Ube3b	UTSW	5	114404546	missense	probably damaging	0.98
R9537:Ube3b	UTSW	5	114387184	missense	probably damaging	1.00
R9596:Ube3b	UTSW	5	114389110	missense	probably damaging	1.00
R9632:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
R9710:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- CTTACGTACCTGGATGACCTGC -3'
(R):5'- GTGCCACATGCTTTCTGAATG -3'

Sequencing Primer
(F):5'- TGGATGACCTGCTGCCCAAG -3'
(R):5'- ACATGCTTTCTGAATGTCTTCTTG -3'

Posted On

2022-10-21