Incidental Mutation 'R9315:Ldlr'
ID 731328
Institutional Source Beutler Lab
Gene Symbol Ldlr
Ensembl Gene ENSMUSG00000032193
Gene Name low density lipoprotein receptor
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9315 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 21634872-21661215 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 21644782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034713] [ENSMUST00000213114]
AlphaFold P35951
Predicted Effect probably benign
Transcript: ENSMUST00000034713
SMART Domains Protein: ENSMUSP00000034713
Gene: ENSMUSG00000032193

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
LDLa 26 65 1.89e-14 SMART
LDLa 67 106 9.81e-13 SMART
EGF_like 108 144 6.81e1 SMART
LDLa 108 145 3.77e-14 SMART
LDLa 147 186 6.67e-15 SMART
LDLa 197 234 1.16e-14 SMART
LDLa 236 273 3.24e-13 SMART
LDLa 276 316 1e-9 SMART
EGF 318 354 3.2e-4 SMART
EGF_CA 355 394 4.09e-11 SMART
LY 420 462 1.11e-3 SMART
LY 466 508 4.7e-11 SMART
LY 509 552 5.23e-9 SMART
LY 553 595 7.86e-13 SMART
LY 596 639 3.25e-5 SMART
EGF 666 713 7.64e-2 SMART
low complexity region 799 811 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213114
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous targeted mutants exhibit 2X higher total plasma cholesterol and 7-9X higher IDL and LDL levels on a normal diet compared to controls. On a high cholesterol diet, mutant effects dramatically increase and mice develop xanthomatosis and atherosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C T 11: 94,265,576 (GRCm39) R153H possibly damaging Het
Ankrd17 G A 5: 90,398,360 (GRCm39) S1730L probably damaging Het
Ano3 T C 2: 110,528,287 (GRCm39) E509G probably damaging Het
Cacna2d4 G T 6: 119,213,670 (GRCm39) A30S probably benign Het
Clec4e A G 6: 123,263,214 (GRCm39) S109P probably damaging Het
Coa7 T A 4: 108,195,581 (GRCm39) L170Q probably benign Het
Col1a2 T A 6: 4,540,544 (GRCm39) I1334N unknown Het
Col6a3 A G 1: 90,738,979 (GRCm39) probably null Het
Cyp2j6 A G 4: 96,420,035 (GRCm39) I232T probably benign Het
Ddx52 T A 11: 83,837,033 (GRCm39) S175T probably benign Het
Dnah11 G A 12: 118,143,341 (GRCm39) S434F probably benign Het
Epn1 T C 7: 5,096,339 (GRCm39) V211A probably benign Het
Fads2b C A 2: 85,319,188 (GRCm39) K371N probably benign Het
Glb1 A G 9: 114,285,548 (GRCm39) N429S probably benign Het
Ifng A T 10: 118,278,588 (GRCm39) D83V probably damaging Het
Ints4 A G 7: 97,156,840 (GRCm39) probably benign Het
Lamb2 C T 9: 108,364,366 (GRCm39) R1102W possibly damaging Het
Mdn1 T C 4: 32,760,911 (GRCm39) V4992A probably benign Het
Mrc1 T A 2: 14,248,969 (GRCm39) C168* probably null Het
Msantd5f3 A T 4: 73,575,280 (GRCm39) R320* probably null Het
Mug1 T A 6: 121,850,730 (GRCm39) V742D possibly damaging Het
Mxd1 T C 6: 86,627,926 (GRCm39) D204G probably damaging Het
Myo9b C A 8: 71,801,811 (GRCm39) A1322D possibly damaging Het
Nepn T A 10: 52,267,869 (GRCm39) I45N probably benign Het
Or13a22 T C 7: 140,072,935 (GRCm39) I128T probably damaging Het
Or14c46 A T 7: 85,918,495 (GRCm39) C167* probably null Het
Or4d5 T C 9: 40,012,270 (GRCm39) D172G probably benign Het
Paip1 A G 13: 119,586,516 (GRCm39) E271G probably benign Het
Pcnx2 T C 8: 126,614,119 (GRCm39) N444S probably benign Het
Pdcd6ip T C 9: 113,488,921 (GRCm39) T705A possibly damaging Het
Pik3r1 A G 13: 101,894,166 (GRCm39) M1T probably null Het
Rab33b T G 3: 51,401,000 (GRCm39) V158G probably damaging Het
Rab6a A G 7: 100,281,017 (GRCm39) I120V probably benign Het
Radil G T 5: 142,474,254 (GRCm39) H731N probably damaging Het
Rbm4b T C 19: 4,812,028 (GRCm39) S146P probably damaging Het
Rrn3 T C 16: 13,606,690 (GRCm39) Y99H probably benign Het
Saxo4 T A 19: 10,458,767 (GRCm39) S88C probably damaging Het
Syne1 G T 10: 5,283,553 (GRCm39) T1504K possibly damaging Het
Tas1r2 A G 4: 139,381,046 (GRCm39) Y56C possibly damaging Het
Tmprss3 T C 17: 31,403,644 (GRCm39) I386V probably null Het
Tns1 A G 1: 73,980,141 (GRCm39) C11R Het
Wdr11 A G 7: 129,208,264 (GRCm39) T340A probably benign Het
Zbtb49 A G 5: 38,358,082 (GRCm39) S724P probably benign Het
Zfp446 A G 7: 12,713,397 (GRCm39) K221R probably benign Het
Other mutations in Ldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Ldlr APN 9 21,646,657 (GRCm39) critical splice donor site probably null
IGL01975:Ldlr APN 9 21,644,993 (GRCm39) missense probably benign 0.05
IGL02043:Ldlr APN 9 21,644,795 (GRCm39) missense probably benign 0.03
IGL02524:Ldlr APN 9 21,644,977 (GRCm39) missense probably damaging 1.00
IGL03049:Ldlr APN 9 21,657,115 (GRCm39) missense probably benign 0.00
IGL03113:Ldlr APN 9 21,651,124 (GRCm39) missense possibly damaging 0.85
R0240:Ldlr UTSW 9 21,649,295 (GRCm39) splice site probably benign
R0586:Ldlr UTSW 9 21,651,040 (GRCm39) missense probably benign 0.00
R1398:Ldlr UTSW 9 21,650,838 (GRCm39) missense probably benign 0.01
R1587:Ldlr UTSW 9 21,649,209 (GRCm39) missense probably damaging 0.99
R2198:Ldlr UTSW 9 21,643,698 (GRCm39) missense probably damaging 1.00
R3730:Ldlr UTSW 9 21,643,097 (GRCm39) missense probably benign 0.09
R4422:Ldlr UTSW 9 21,649,248 (GRCm39) missense probably damaging 1.00
R5044:Ldlr UTSW 9 21,646,538 (GRCm39) missense probably benign 0.00
R5046:Ldlr UTSW 9 21,657,203 (GRCm39) critical splice donor site probably null
R6186:Ldlr UTSW 9 21,635,055 (GRCm39) start gained probably benign
R6195:Ldlr UTSW 9 21,643,077 (GRCm39) nonsense probably null
R6523:Ldlr UTSW 9 21,648,549 (GRCm39) missense probably damaging 1.00
R6682:Ldlr UTSW 9 21,643,671 (GRCm39) missense probably benign
R7256:Ldlr UTSW 9 21,657,040 (GRCm39) missense probably benign 0.01
R7384:Ldlr UTSW 9 21,651,090 (GRCm39) missense probably benign 0.07
R7823:Ldlr UTSW 9 21,653,602 (GRCm39) critical splice donor site probably null
R8065:Ldlr UTSW 9 21,649,241 (GRCm39) missense probably damaging 1.00
R8223:Ldlr UTSW 9 21,658,546 (GRCm39) missense probably damaging 1.00
R8732:Ldlr UTSW 9 21,650,985 (GRCm39) missense probably benign 0.00
R8931:Ldlr UTSW 9 21,643,108 (GRCm39) missense probably damaging 0.99
R8954:Ldlr UTSW 9 21,650,828 (GRCm39) missense possibly damaging 0.87
R9489:Ldlr UTSW 9 21,646,626 (GRCm39) missense probably damaging 1.00
R9517:Ldlr UTSW 9 21,655,240 (GRCm39) missense possibly damaging 0.90
R9605:Ldlr UTSW 9 21,646,626 (GRCm39) missense probably damaging 1.00
R9709:Ldlr UTSW 9 21,657,135 (GRCm39) missense probably benign 0.00
X0024:Ldlr UTSW 9 21,651,114 (GRCm39) missense probably damaging 1.00
Z1177:Ldlr UTSW 9 21,651,126 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATTAAGATGTGGCTCAATACCC -3'
(R):5'- ATATGGATGAGTTGCAGCGG -3'

Sequencing Primer
(F):5'- CAGAACTGGCTTGATAGTTGACC -3'
(R):5'- TTGCAGCGGAAGTGGGC -3'
Posted On 2022-11-01