Mutagenetix > Incidental Mutation

Incidental Mutation 'R9315:Ldlr'

731328

Institutional Source

Beutler Lab

Gene Symbol

Ldlr

Ensembl Gene

ENSMUSG00000032193

Gene Name

low density lipoprotein receptor

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9315 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21723483-21749919 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 21733486 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000149431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034713] [ENSMUST00000213114]

AlphaFold

P35951

Predicted Effect

probably benign
Transcript: ENSMUST00000034713

SMART Domains

Protein: ENSMUSP00000034713
Gene: ENSMUSG00000032193

Domain	Start	End	E-Value	Type
low complexity region	13	23	N/A	INTRINSIC
LDLa	26	65	1.89e-14	SMART
LDLa	67	106	9.81e-13	SMART
EGF_like	108	144	6.81e1	SMART
LDLa	108	145	3.77e-14	SMART
LDLa	147	186	6.67e-15	SMART
LDLa	197	234	1.16e-14	SMART
LDLa	236	273	3.24e-13	SMART
LDLa	276	316	1e-9	SMART
EGF	318	354	3.2e-4	SMART
EGF_CA	355	394	4.09e-11	SMART
LY	420	462	1.11e-3	SMART
LY	466	508	4.7e-11	SMART
LY	509	552	5.23e-9	SMART
LY	553	595	7.86e-13	SMART
LY	596	639	3.25e-5	SMART
EGF	666	713	7.64e-2	SMART
low complexity region	799	811	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000213114

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous targeted mutants exhibit 2X higher total plasma cholesterol and 7-9X higher IDL and LDL levels on a normal diet compared to controls. On a high cholesterol diet, mutant effects dramatically increase and mice develop xanthomatosis and atherosclerosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	C	A	2: 85,488,844	K371N	probably benign	Het
Abcc3	C	T	11: 94,374,750	R153H	possibly damaging	Het
Ankrd17	G	A	5: 90,250,501	S1730L	probably damaging	Het
Ano3	T	C	2: 110,697,942	E509G	probably damaging	Het
Cacna2d4	G	T	6: 119,236,709	A30S	probably benign	Het
Clec4e	A	G	6: 123,286,255	S109P	probably damaging	Het
Coa7	T	A	4: 108,338,384	L170Q	probably benign	Het
Col1a2	T	A	6: 4,540,544	I1334N	unknown	Het
Col6a3	A	G	1: 90,811,257		probably null	Het
Cyp2j6	A	G	4: 96,531,798	I232T	probably benign	Het
Ddx52	T	A	11: 83,946,207	S175T	probably benign	Het
Dnah11	G	A	12: 118,179,606	S434F	probably benign	Het
Epn1	T	C	7: 5,093,340	V211A	probably benign	Het
Glb1	A	G	9: 114,456,480	N429S	probably benign	Het
Gm11238	A	T	4: 73,657,043	R320*	probably null	Het
Ifng	A	T	10: 118,442,683	D83V	probably damaging	Het
Ints4	A	G	7: 97,507,633		probably benign	Het
Lamb2	C	T	9: 108,487,167	R1102W	possibly damaging	Het
Mdn1	T	C	4: 32,760,911	V4992A	probably benign	Het
Mrc1	T	A	2: 14,244,158	C168*	probably null	Het
Mug1	T	A	6: 121,873,771	V742D	possibly damaging	Het
Mxd1	T	C	6: 86,650,944	D204G	probably damaging	Het
Myo9b	C	A	8: 71,349,167	A1322D	possibly damaging	Het
Nepn	T	A	10: 52,391,773	I45N	probably benign	Het
Olfr310	A	T	7: 86,269,287	C167*	probably null	Het
Olfr535	T	C	7: 140,493,022	I128T	probably damaging	Het
Olfr984	T	C	9: 40,100,974	D172G	probably benign	Het
Paip1	A	G	13: 119,449,980	E271G	probably benign	Het
Pcnx2	T	C	8: 125,887,380	N444S	probably benign	Het
Pdcd6ip	T	C	9: 113,659,853	T705A	possibly damaging	Het
Pik3r1	A	G	13: 101,757,658	M1T	probably null	Het
Ppp1r32	T	A	19: 10,481,403	S88C	probably damaging	Het
Rab33b	T	G	3: 51,493,579	V158G	probably damaging	Het
Rab6a	A	G	7: 100,631,810	I120V	probably benign	Het
Radil	G	T	5: 142,488,499	H731N	probably damaging	Het
Rbm4b	T	C	19: 4,762,000	S146P	probably damaging	Het
Rrn3	T	C	16: 13,788,826	Y99H	probably benign	Het
Syne1	G	T	10: 5,333,553	T1504K	possibly damaging	Het
Tas1r2	A	G	4: 139,653,735	Y56C	possibly damaging	Het
Tmprss3	T	C	17: 31,184,670	I386V	probably null	Het
Tns1	A	G	1: 73,940,982	C11R		Het
Wdr11	A	G	7: 129,606,540	T340A	probably benign	Het
Zbtb49	A	G	5: 38,200,738	S724P	probably benign	Het
Zfp446	A	G	7: 12,979,470	K221R	probably benign	Het

Other mutations in Ldlr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Ldlr	APN	9	21735361	critical splice donor site	probably null
IGL01975:Ldlr	APN	9	21733697	missense	probably benign	0.05
IGL02043:Ldlr	APN	9	21733499	missense	probably benign	0.03
IGL02524:Ldlr	APN	9	21733681	missense	probably damaging	1.00
IGL03049:Ldlr	APN	9	21745819	missense	probably benign	0.00
IGL03113:Ldlr	APN	9	21739828	missense	possibly damaging	0.85
R0240:Ldlr	UTSW	9	21737999	splice site	probably benign
R0586:Ldlr	UTSW	9	21739744	missense	probably benign	0.00
R1398:Ldlr	UTSW	9	21739542	missense	probably benign	0.01
R1587:Ldlr	UTSW	9	21737913	missense	probably damaging	0.99
R2198:Ldlr	UTSW	9	21732402	missense	probably damaging	1.00
R3730:Ldlr	UTSW	9	21731801	missense	probably benign	0.09
R4422:Ldlr	UTSW	9	21737952	missense	probably damaging	1.00
R5044:Ldlr	UTSW	9	21735242	missense	probably benign	0.00
R5046:Ldlr	UTSW	9	21745907	critical splice donor site	probably null
R6186:Ldlr	UTSW	9	21723759	start gained	probably benign
R6195:Ldlr	UTSW	9	21731781	nonsense	probably null
R6523:Ldlr	UTSW	9	21737253	missense	probably damaging	1.00
R6682:Ldlr	UTSW	9	21732375	missense	probably benign
R7256:Ldlr	UTSW	9	21745744	missense	probably benign	0.01
R7384:Ldlr	UTSW	9	21739794	missense	probably benign	0.07
R7823:Ldlr	UTSW	9	21742306	critical splice donor site	probably null
R8065:Ldlr	UTSW	9	21737945	missense	probably damaging	1.00
R8223:Ldlr	UTSW	9	21747250	missense	probably damaging	1.00
R8732:Ldlr	UTSW	9	21739689	missense	probably benign	0.00
R8931:Ldlr	UTSW	9	21731812	missense	probably damaging	0.99
R8954:Ldlr	UTSW	9	21739532	missense	possibly damaging	0.87
R9489:Ldlr	UTSW	9	21735330	missense	probably damaging	1.00
R9517:Ldlr	UTSW	9	21743944	missense	possibly damaging	0.90
R9605:Ldlr	UTSW	9	21735330	missense	probably damaging	1.00
R9709:Ldlr	UTSW	9	21745839	missense	probably benign	0.00
X0024:Ldlr	UTSW	9	21739818	missense	probably damaging	1.00
Z1177:Ldlr	UTSW	9	21739830	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCATTAAGATGTGGCTCAATACCC -3'
(R):5'- ATATGGATGAGTTGCAGCGG -3'

Sequencing Primer
(F):5'- CAGAACTGGCTTGATAGTTGACC -3'
(R):5'- TTGCAGCGGAAGTGGGC -3'

Posted On

2022-11-01