Incidental Mutation 'R9343:Itgb5'
ID 731361
Institutional Source Beutler Lab
Gene Symbol Itgb5
Ensembl Gene ENSMUSG00000022817
Gene Name integrin beta 5
Synonyms ESTM23, [b]-5, beta-5, beta5, [b]5, [b]5A, [b]5B
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9343 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 33829665-33949338 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 33910456 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069345] [ENSMUST00000115028] [ENSMUST00000232262]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000069345
SMART Domains Protein: ENSMUSP00000069416
Gene: ENSMUSG00000022817

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115028
SMART Domains Protein: ENSMUSP00000110680
Gene: ENSMUSG00000022817

DomainStartEndE-ValueType
PSI 27 76 1.4e-7 SMART
INB 35 463 1.18e-284 SMART
VWA 137 372 5.95e-7 SMART
internal_repeat_1 492 549 3.16e-7 PROSPERO
EGF 554 586 1.95e1 SMART
Integrin_B_tail 635 719 1.56e-21 SMART
Integrin_b_cyt 743 790 5.97e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232262
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation do not appear to differ from normal in respect to development, reproduction, adenovirus infection, or wound healing. Mutant keratinocytes do show reduced migration on, and adhesion to, vitronectin in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A G 2: 103,717,160 I960V probably benign Het
Alpk3 A G 7: 81,092,331 D632G probably benign Het
Aplp2 A T 9: 31,211,639 L30Q unknown Het
Axl A T 7: 25,774,119 Y361N probably damaging Het
Brinp2 A T 1: 158,249,520 probably benign Het
Bsn T C 9: 108,115,502 D1017G probably damaging Het
Cc2d2a A T 5: 43,718,657 D1046V probably damaging Het
Cdc42bpg G A 19: 6,314,523 G594S probably damaging Het
Clcn6 A G 4: 148,014,001 S519P probably benign Het
Cnot2 T G 10: 116,510,421 H92P Het
Col2a1 T C 15: 97,979,894 D1049G probably damaging Het
Creld1 C T 6: 113,489,767 A237V probably benign Het
Csf2rb2 A T 15: 78,287,087 probably benign Het
Csmd3 G A 15: 48,151,605 T643I probably damaging Het
Fam186b G A 15: 99,279,735 A570V probably damaging Het
Fcmr A T 1: 130,874,335 T109S Het
Grap C A 11: 61,671,725 P174Q possibly damaging Het
Kidins220 A G 12: 25,008,079 N561S probably damaging Het
Mkl2 T C 16: 13,400,927 V479A probably benign Het
Mri1 A T 8: 84,257,167 S32T probably benign Het
Muc4 A T 16: 32,751,153 T344S possibly damaging Het
Npc1 A G 18: 12,201,712 I661T possibly damaging Het
Npy1r A G 8: 66,704,099 N57S probably damaging Het
Pds5b A G 5: 150,780,721 D863G probably damaging Het
Phf14 T A 6: 11,961,564 V400D probably damaging Het
Polr2l A G 7: 141,473,333 I56T probably benign Het
Ppat A G 5: 76,916,037 I422T probably benign Het
Prkcg T A 7: 3,310,608 S110R possibly damaging Het
Rab7b A T 1: 131,711,802 probably benign Het
Rnf152 A T 1: 105,284,526 L102Q Het
Samd12 A G 15: 53,719,692 V82A probably damaging Het
Serpina1e T A 12: 103,951,040 R123S probably benign Het
Slit1 T A 19: 41,627,298 N794I probably damaging Het
Surf6 T C 2: 26,892,994 K154R probably damaging Het
Tln2 C T 9: 67,323,071 A71T probably benign Het
Trim3 A G 7: 105,611,466 Y649H probably benign Het
Ttll7 T A 3: 146,961,742 W808R probably damaging Het
Tvp23a T C 16: 10,427,423 D104G probably damaging Het
Upp2 A G 2: 58,755,327 probably benign Het
Vipr1 G A 9: 121,642,927 probably null Het
Vmn1r119 A G 7: 21,012,433 V8A probably benign Het
Vmn1r209 T A 13: 22,806,376 H48L probably damaging Het
Wdr11 T C 7: 129,630,799 probably null Het
Zcchc17 T C 4: 130,316,753 D207G probably damaging Het
Zfp78 T C 7: 6,378,943 S331P probably damaging Het
Other mutations in Itgb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Itgb5 APN 16 33884975 missense probably damaging 1.00
IGL01121:Itgb5 APN 16 33919989 missense probably benign 0.00
IGL01620:Itgb5 APN 16 33919798 missense probably damaging 1.00
IGL02332:Itgb5 APN 16 33920130 nonsense probably null
IGL02869:Itgb5 APN 16 33844992 missense possibly damaging 0.94
IGL02881:Itgb5 APN 16 33919905 missense probably benign 0.00
IGL02941:Itgb5 APN 16 33944095 splice site probably benign
IGL03216:Itgb5 APN 16 33902838 missense probably benign 0.38
IGL03351:Itgb5 APN 16 33910552 missense probably benign 0.00
PIT4812001:Itgb5 UTSW 16 33919987 missense probably damaging 1.00
R0744:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R0829:Itgb5 UTSW 16 33944201 missense probably benign 0.29
R0836:Itgb5 UTSW 16 33900583 missense probably damaging 0.99
R1387:Itgb5 UTSW 16 33900515 nonsense probably null
R1703:Itgb5 UTSW 16 33910500 missense probably benign 0.01
R1783:Itgb5 UTSW 16 33940562 missense probably benign 0.13
R1826:Itgb5 UTSW 16 33865560 missense possibly damaging 0.48
R1889:Itgb5 UTSW 16 33910469 missense probably damaging 1.00
R2374:Itgb5 UTSW 16 33919798 missense probably damaging 1.00
R4307:Itgb5 UTSW 16 33948732 missense possibly damaging 0.80
R4355:Itgb5 UTSW 16 33844997 missense probably damaging 0.98
R4796:Itgb5 UTSW 16 33885021 missense possibly damaging 0.83
R4879:Itgb5 UTSW 16 33875978 missense probably damaging 1.00
R6165:Itgb5 UTSW 16 33899242 missense probably benign 0.01
R6584:Itgb5 UTSW 16 33885030 missense probably damaging 1.00
R6617:Itgb5 UTSW 16 33946592 missense probably benign 0.01
R6748:Itgb5 UTSW 16 33899297 missense probably damaging 1.00
R6979:Itgb5 UTSW 16 33919986 missense probably damaging 1.00
R7090:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7150:Itgb5 UTSW 16 33940643 missense probably benign 0.03
R7403:Itgb5 UTSW 16 33902793 critical splice acceptor site probably null
R7418:Itgb5 UTSW 16 33885094 missense probably damaging 1.00
R7719:Itgb5 UTSW 16 33920116 missense probably benign 0.01
R8309:Itgb5 UTSW 16 33865553 missense probably benign 0.00
R8347:Itgb5 UTSW 16 33940678 missense probably damaging 1.00
R8856:Itgb5 UTSW 16 33900592 missense probably damaging 1.00
R9100:Itgb5 UTSW 16 33920181 missense possibly damaging 0.91
R9194:Itgb5 UTSW 16 33900511 missense probably damaging 1.00
R9309:Itgb5 UTSW 16 33920046 missense probably benign 0.00
R9629:Itgb5 UTSW 16 33875925 missense probably damaging 1.00
R9683:Itgb5 UTSW 16 33919965 missense probably damaging 0.97
R9710:Itgb5 UTSW 16 33865547 missense probably benign 0.00
X0022:Itgb5 UTSW 16 33845050 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ATTCCAAGCTCACAGAGGGAG -3'
(R):5'- GGGAGCTACAAAATTGTCAGATTC -3'

Sequencing Primer
(F):5'- AGGGCCAAGTCAGGTCTAC -3'
(R):5'- GATTCAGAGAATAATTACCCAAGCG -3'
Posted On 2022-11-09