Incidental Mutation 'R9344:Irs2'
ID 731362
Institutional Source Beutler Lab
Gene Symbol Irs2
Ensembl Gene ENSMUSG00000038894
Gene Name insulin receptor substrate 2
Synonyms Irs-2
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.579) question?
Stock # R9344 (G1)
Quality Score 58.0073
Status Validated
Chromosome 8
Chromosomal Location 11034681-11058458 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 11057289 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 381 (S381*)
Ref Sequence ENSEMBL: ENSMUSP00000038514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040514]
AlphaFold P81122
PDB Structure Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide and ATP [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB phosphopeptide [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000040514
AA Change: S381*
SMART Domains Protein: ENSMUSP00000038514
Gene: ENSMUSG00000038894
AA Change: S381*

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 19 28 N/A INTRINSIC
PH 31 146 2.83e-13 SMART
IRS 191 293 4.98e-38 SMART
PTBI 191 293 2.24e-51 SMART
low complexity region 301 309 N/A INTRINSIC
low complexity region 364 377 N/A INTRINSIC
low complexity region 435 473 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 688 710 N/A INTRINSIC
low complexity region 721 730 N/A INTRINSIC
low complexity region 834 846 N/A INTRINSIC
low complexity region 923 959 N/A INTRINSIC
low complexity region 976 984 N/A INTRINSIC
low complexity region 997 1028 N/A INTRINSIC
low complexity region 1137 1154 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
low complexity region 1274 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in type 2 diabetes due to insulin resistance and pancreatic beta cell dysfunction, causes defects in leptin action, energy balance, lipid homeostasis and vascular wound healing, and leads to female infertility due to hypothalamic and ovarian dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik A G 16: 64,591,135 (GRCm39) V31A possibly damaging Het
Adss2 A G 1: 177,597,527 (GRCm39) Y378H probably damaging Het
Aldh1a1 T A 19: 20,608,150 (GRCm39) V324D probably damaging Het
Ankrd33b A G 15: 31,297,903 (GRCm39) S285P probably damaging Het
Arel1 C T 12: 84,981,371 (GRCm39) G269S probably damaging Het
Arhgap44 A G 11: 65,053,463 (GRCm39) M1T probably null Het
Arpin C T 7: 79,577,983 (GRCm39) V149I probably benign Het
Arpp21 A G 9: 112,014,720 (GRCm39) L28P possibly damaging Het
Ccr8 G A 9: 119,923,133 (GRCm39) V83I probably damaging Het
Cnksr1 T C 4: 133,963,508 (GRCm39) E58G probably damaging Het
Dctn2 T A 10: 127,114,084 (GRCm39) H341Q probably damaging Het
Ddx21 C A 10: 62,428,825 (GRCm39) A362S possibly damaging Het
Dnajc1 C T 2: 18,289,586 (GRCm39) V274I probably benign Het
Dock3 A C 9: 106,870,763 (GRCm39) C550W probably damaging Het
Dst T C 1: 34,220,676 (GRCm39) L2160S probably damaging Het
Duox1 T A 2: 122,168,163 (GRCm39) M1096K probably benign Het
Dync2h1 A T 9: 7,148,659 (GRCm39) D928E probably benign Het
E030025P04Rik C T 11: 109,030,454 (GRCm39) probably null Het
Eid2b T C 7: 27,977,591 (GRCm39) M129T possibly damaging Het
Fnip2 G A 3: 79,407,717 (GRCm39) S288F possibly damaging Het
Grm4 G T 17: 27,653,737 (GRCm39) R738S probably benign Het
Gsto2 A G 19: 47,864,884 (GRCm39) D139G probably benign Het
Herc2 T A 7: 55,772,112 (GRCm39) V1097E probably benign Het
Impg1 G A 9: 80,312,040 (GRCm39) A181V probably benign Het
Itprid1 C T 6: 55,955,470 (GRCm39) T1026I probably benign Het
Lrrd1 A C 5: 3,908,819 (GRCm39) D697A possibly damaging Het
Nat10 A G 2: 103,573,460 (GRCm39) S346P probably damaging Het
Ncapg2 G A 12: 116,388,273 (GRCm39) R319H probably damaging Het
Nid1 A G 13: 13,652,894 (GRCm39) Y568C probably damaging Het
Noc2l G A 4: 156,325,130 (GRCm39) C325Y probably damaging Het
Or12e9 A T 2: 87,202,161 (GRCm39) D95V possibly damaging Het
Or1e17 C A 11: 73,831,744 (GRCm39) S224Y possibly damaging Het
Pde2a G T 7: 101,144,891 (GRCm39) V169F possibly damaging Het
Pon3 T C 6: 5,221,586 (GRCm39) K348R probably benign Het
Ppp6c A G 2: 39,090,052 (GRCm39) probably null Het
Prrc2b G A 2: 32,103,600 (GRCm39) G1026D probably benign Het
Psg22 A T 7: 18,460,816 (GRCm39) T482S possibly damaging Het
Rdh19 G A 10: 127,692,740 (GRCm39) V136M probably damaging Het
Sbf2 T A 7: 109,940,535 (GRCm39) N1275I probably benign Het
Sema4c T C 1: 36,592,395 (GRCm39) N182D probably damaging Het
Slc7a12 T A 3: 14,570,491 (GRCm39) H414Q probably damaging Het
Slitrk5 A G 14: 111,916,702 (GRCm39) I109V probably damaging Het
Spag17 C T 3: 100,010,793 (GRCm39) P2096S probably benign Het
Steap1 T A 5: 5,786,459 (GRCm39) D326V probably damaging Het
Tacr1 C T 6: 82,380,847 (GRCm39) T86I probably damaging Het
Tenm4 C T 7: 96,545,352 (GRCm39) T2493I probably damaging Het
Tet2 A G 3: 133,175,115 (GRCm39) S1411P possibly damaging Het
Tom1 C T 8: 75,785,076 (GRCm39) R303C probably damaging Het
Trav7n-4 T A 14: 53,329,200 (GRCm39) I70N possibly damaging Het
Utrn A C 10: 12,560,275 (GRCm39) V1338G probably benign Het
Vipr1 G A 9: 121,471,993 (GRCm39) probably null Het
Vmn1r122 A T 7: 20,867,271 (GRCm39) H261Q probably benign Het
Vmn1r40 G T 6: 89,691,235 (GRCm39) L17F probably benign Het
Vmn2r54 A G 7: 12,366,283 (GRCm39) V217A probably benign Het
Vmn2r55 C A 7: 12,385,782 (GRCm39) G733* probably null Het
Vmn2r98 A T 17: 19,286,777 (GRCm39) N425I probably benign Het
Vps51 C T 19: 6,126,345 (GRCm39) V136I unknown Het
Zfp184 T C 13: 22,144,411 (GRCm39) C706R probably damaging Het
Other mutations in Irs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Irs2 APN 8 11,055,867 (GRCm39) missense probably benign 0.00
IGL01328:Irs2 APN 8 11,054,792 (GRCm39) missense probably damaging 0.99
IGL01875:Irs2 APN 8 11,056,221 (GRCm39) missense probably damaging 0.98
IGL02444:Irs2 APN 8 11,056,306 (GRCm39) missense probably benign 0.03
IGL02448:Irs2 APN 8 11,057,862 (GRCm39) missense probably benign 0.21
IGL02945:Irs2 APN 8 11,057,781 (GRCm39) missense probably damaging 1.00
IGL03068:Irs2 APN 8 11,054,974 (GRCm39) missense probably damaging 0.99
beefed UTSW 8 11,056,522 (GRCm39) nonsense probably null
Dum_dum UTSW 8 11,037,012 (GRCm39) makesense probably null
Lush UTSW 8 11,056,678 (GRCm39) nonsense probably null
muscular UTSW 8 11,054,659 (GRCm39) nonsense probably null
Plink UTSW 8 11,055,121 (GRCm39) missense probably damaging 0.99
R0062:Irs2 UTSW 8 11,055,723 (GRCm39) missense possibly damaging 0.65
R0062:Irs2 UTSW 8 11,055,723 (GRCm39) missense possibly damaging 0.65
R0107:Irs2 UTSW 8 11,054,691 (GRCm39) missense probably damaging 1.00
R0147:Irs2 UTSW 8 11,057,568 (GRCm39) missense probably damaging 1.00
R0501:Irs2 UTSW 8 11,056,396 (GRCm39) missense probably damaging 1.00
R0565:Irs2 UTSW 8 11,054,592 (GRCm39) missense probably damaging 0.98
R2042:Irs2 UTSW 8 11,057,580 (GRCm39) missense probably damaging 0.99
R2268:Irs2 UTSW 8 11,057,586 (GRCm39) missense probably damaging 0.98
R2518:Irs2 UTSW 8 11,055,352 (GRCm39) missense probably benign 0.00
R2762:Irs2 UTSW 8 11,056,408 (GRCm39) missense probably damaging 1.00
R3623:Irs2 UTSW 8 11,057,643 (GRCm39) missense probably damaging 1.00
R3624:Irs2 UTSW 8 11,057,643 (GRCm39) missense probably damaging 1.00
R5022:Irs2 UTSW 8 11,037,012 (GRCm39) makesense probably null
R5270:Irs2 UTSW 8 11,056,678 (GRCm39) nonsense probably null
R5377:Irs2 UTSW 8 11,055,277 (GRCm39) missense probably benign 0.00
R5604:Irs2 UTSW 8 11,055,007 (GRCm39) missense possibly damaging 0.84
R6049:Irs2 UTSW 8 11,056,805 (GRCm39) missense probably benign 0.01
R6219:Irs2 UTSW 8 11,055,121 (GRCm39) missense probably damaging 0.99
R6654:Irs2 UTSW 8 11,056,486 (GRCm39) missense probably damaging 1.00
R6726:Irs2 UTSW 8 11,054,961 (GRCm39) missense possibly damaging 0.86
R6813:Irs2 UTSW 8 11,054,659 (GRCm39) nonsense probably null
R6934:Irs2 UTSW 8 11,054,697 (GRCm39) missense probably damaging 0.99
R7261:Irs2 UTSW 8 11,057,018 (GRCm39) missense possibly damaging 0.95
R7285:Irs2 UTSW 8 11,056,797 (GRCm39) missense probably damaging 0.99
R7458:Irs2 UTSW 8 11,057,739 (GRCm39) missense probably damaging 0.99
R7757:Irs2 UTSW 8 11,056,522 (GRCm39) nonsense probably null
R8347:Irs2 UTSW 8 11,058,000 (GRCm39) missense possibly damaging 0.82
R8348:Irs2 UTSW 8 11,054,974 (GRCm39) missense probably damaging 0.98
R8377:Irs2 UTSW 8 11,054,848 (GRCm39) nonsense probably null
R8444:Irs2 UTSW 8 11,056,683 (GRCm39) missense probably damaging 0.99
R8912:Irs2 UTSW 8 11,056,655 (GRCm39) missense probably damaging 0.96
R9229:Irs2 UTSW 8 11,057,400 (GRCm39) missense probably damaging 1.00
R9405:Irs2 UTSW 8 11,055,061 (GRCm39) missense possibly damaging 0.95
R9484:Irs2 UTSW 8 11,057,334 (GRCm39) missense probably damaging 0.99
R9736:Irs2 UTSW 8 11,058,217 (GRCm39) missense probably damaging 1.00
Z1176:Irs2 UTSW 8 11,056,185 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCGTCAAGGGACATGAAACCC -3'
(R):5'- AAGAGCTCTTCGAGTTCCGG -3'

Sequencing Primer
(F):5'- ATGAAACCCGGGTCGCTG -3'
(R):5'- TCGCAGCAAGAGTCAGTC -3'
Posted On 2022-11-09