Incidental Mutation 'R9069:Clca3a2'
ID 731363
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Name chloride channel accessory 3A2
Synonyms Clca2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R9069 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144502320-144525255 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 144519447 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929]
AlphaFold Q9EQR4
Predicted Effect probably benign
Transcript: ENSMUST00000029929
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,818,523 (GRCm39) C103S probably damaging Het
Adamts20 T C 15: 94,236,349 (GRCm39) S841G probably benign Het
Add3 T A 19: 53,222,332 (GRCm39) V313E possibly damaging Het
Ahr G T 12: 35,562,771 (GRCm39) probably benign Het
Ankrd12 T A 17: 66,356,874 (GRCm39) M48L probably benign Het
Apaf1 A C 10: 90,859,580 (GRCm39) probably null Het
Bank1 T C 3: 135,989,772 (GRCm39) H106R probably benign Het
Birc6 A G 17: 74,868,260 (GRCm39) probably benign Het
Castor1 A G 11: 4,170,141 (GRCm39) E73G probably benign Het
Ccdc170 C T 10: 4,511,016 (GRCm39) H692Y possibly damaging Het
Cd93 A G 2: 148,284,071 (GRCm39) I425T probably benign Het
Celsr1 A C 15: 85,914,772 (GRCm39) L1067R possibly damaging Het
Col14a1 T C 15: 55,251,990 (GRCm39) S549P unknown Het
Col6a4 A G 9: 105,952,138 (GRCm39) S587P possibly damaging Het
Crebbp C A 16: 3,903,187 (GRCm39) M2017I probably benign Het
Crybg1 A C 10: 43,874,103 (GRCm39) F1002V probably benign Het
Ctif T C 18: 75,654,458 (GRCm39) E356G probably damaging Het
Dbx2 T C 15: 95,530,239 (GRCm39) K243E probably damaging Het
Dgkh C T 14: 78,853,957 (GRCm39) V394I probably damaging Het
Dnaja4 T A 9: 54,621,638 (GRCm39) M321K probably benign Het
Dock9 T C 14: 121,866,324 (GRCm39) N593S probably damaging Het
Dot1l T A 10: 80,626,560 (GRCm39) S1260R probably damaging Het
Eea1 A T 10: 95,831,510 (GRCm39) L200F probably damaging Het
Elp2 T G 18: 24,765,833 (GRCm39) F658V probably benign Het
Fbxw15 G A 9: 109,394,468 (GRCm39) Q116* probably null Het
Fstl5 A T 3: 76,615,416 (GRCm39) N826Y probably damaging Het
Galp T C 7: 6,214,347 (GRCm39) S60P possibly damaging Het
Gm7298 G T 6: 121,761,393 (GRCm39) M1316I probably benign Het
Gsdmc T C 15: 63,649,902 (GRCm39) M330V probably benign Het
Hectd2 T C 19: 36,562,862 (GRCm39) F175L probably benign Het
Hmbs A G 9: 44,248,102 (GRCm39) I318T possibly damaging Het
Ifi205 T C 1: 173,855,841 (GRCm39) D63G probably benign Het
Il10ra T A 9: 45,167,396 (GRCm39) Q387L probably damaging Het
Kcnj14 C A 7: 45,469,388 (GRCm39) G39V probably benign Het
Kpna1 T C 16: 35,836,381 (GRCm39) probably benign Het
Lrp2 A T 2: 69,331,996 (GRCm39) D1586E probably damaging Het
Lrrc45 A G 11: 120,607,947 (GRCm39) I243V probably benign Het
Lrrc7 T C 3: 157,946,138 (GRCm39) K187R probably benign Het
Mamdc4 G T 2: 25,453,371 (GRCm39) T1216N probably damaging Het
Map1a A C 2: 121,134,145 (GRCm39) K1654Q probably benign Het
Mta2 G A 19: 8,924,104 (GRCm39) V195M probably damaging Het
Nav2 G T 7: 49,208,561 (GRCm39) R1583L probably damaging Het
Or2y1g A T 11: 49,171,247 (GRCm39) T91S probably benign Het
Or4c112 A T 2: 88,854,308 (GRCm39) L13Q probably damaging Het
Or9i14 T C 19: 13,792,735 (GRCm39) Y73C probably damaging Het
Osbpl1a T A 18: 13,002,074 (GRCm39) probably benign Het
Pcdh17 T C 14: 84,685,084 (GRCm39) V517A possibly damaging Het
Pcdhb14 T A 18: 37,583,157 (GRCm39) C754* probably null Het
Pkd1 T C 17: 24,791,988 (GRCm39) V1225A probably damaging Het
Plekhm3 T C 1: 64,960,802 (GRCm39) N485D probably benign Het
Plekho1 A C 3: 95,902,995 (GRCm39) S14A unknown Het
Ppp2r3d A T 9: 101,090,006 (GRCm39) C106S probably benign Het
Ppp6c A C 2: 39,094,928 (GRCm39) L99R probably damaging Het
Pramel27 A G 4: 143,578,345 (GRCm39) S202G probably benign Het
Prkdc T A 16: 15,653,091 (GRCm39) Y3855* probably null Het
Ptpru A T 4: 131,503,565 (GRCm39) I1155N possibly damaging Het
Reln C T 5: 22,216,059 (GRCm39) G1042D probably damaging Het
Sall4 A G 2: 168,596,773 (GRCm39) V689A probably benign Het
Sec31b C T 19: 44,507,741 (GRCm39) G768S probably damaging Het
Serpinb10 T A 1: 107,474,549 (GRCm39) V237D probably benign Het
Serpinb9 T G 13: 33,199,579 (GRCm39) D291E probably benign Het
Slc12a7 T G 13: 73,954,089 (GRCm39) probably benign Het
Slfn8 A T 11: 82,907,902 (GRCm39) F214I probably damaging Het
Slu7 A T 11: 43,328,952 (GRCm39) D58V probably damaging Het
Smu1 T C 4: 40,745,558 (GRCm39) Y254C probably damaging Het
Snapc4 A T 2: 26,260,805 (GRCm39) Y479* probably null Het
Specc1l A G 10: 75,066,640 (GRCm39) N30D probably benign Het
Spopfm1 A C 3: 94,173,153 (GRCm39) S50R possibly damaging Het
Tbck T C 3: 132,428,130 (GRCm39) probably null Het
Tcf7l1 T C 6: 72,610,259 (GRCm39) Y246C probably damaging Het
Tmem43 C T 6: 91,463,897 (GRCm39) R391W possibly damaging Het
Trav7-1 T G 14: 52,892,566 (GRCm39) S40A possibly damaging Het
Trim45 T A 3: 100,832,440 (GRCm39) Y224* probably null Het
Trio A T 15: 27,852,097 (GRCm39) I798N possibly damaging Het
Trnau1ap A T 4: 132,056,662 (GRCm39) probably null Het
Vmn1r213 T C 13: 23,196,043 (GRCm39) S209P probably damaging Het
Ythdf1 G T 2: 180,552,857 (GRCm39) R453S probably damaging Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Clca3a2 APN 3 144,804,574 (GRCm39) missense probably damaging 1.00
IGL01019:Clca3a2 APN 3 144,519,388 (GRCm39) nonsense probably null
IGL01337:Clca3a2 APN 3 144,800,939 (GRCm39) missense probably damaging 1.00
IGL01389:Clca3a2 APN 3 144,783,629 (GRCm39) critical splice donor site probably null
IGL01595:Clca3a2 APN 3 144,793,768 (GRCm39) missense probably damaging 1.00
IGL01663:Clca3a2 APN 3 144,522,916 (GRCm39) missense probably damaging 0.97
IGL01704:Clca3a2 APN 3 144,800,979 (GRCm39) missense probably benign 0.04
IGL01779:Clca3a2 APN 3 144,525,139 (GRCm39) missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144,519,216 (GRCm39) missense probably benign
IGL02301:Clca3a2 APN 3 144,512,133 (GRCm39) missense probably damaging 0.98
IGL02416:Clca3a2 APN 3 144,790,777 (GRCm39) missense probably benign 0.02
IGL02455:Clca3a2 APN 3 144,787,172 (GRCm39) missense probably benign 0.00
IGL02481:Clca3a2 APN 3 144,790,701 (GRCm39) missense possibly damaging 0.92
IGL02526:Clca3a2 APN 3 144,793,779 (GRCm39) missense probably benign 0.02
IGL02619:Clca3a2 APN 3 144,512,083 (GRCm39) missense probably damaging 1.00
IGL02797:Clca3a2 APN 3 144,787,024 (GRCm39) missense probably benign 0.02
IGL02852:Clca3a2 APN 3 144,512,104 (GRCm39) missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144,522,529 (GRCm39) missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144,512,177 (GRCm39) missense probably damaging 1.00
IGL03253:Clca3a2 APN 3 144,777,324 (GRCm39) missense probably benign 0.41
IGL03256:Clca3a2 APN 3 144,792,153 (GRCm39) missense possibly damaging 0.75
IGL03294:Clca3a2 APN 3 144,803,530 (GRCm39) missense probably damaging 1.00
3370:Clca3a2 UTSW 3 144,783,738 (GRCm39) missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144,522,494 (GRCm39) missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144,519,659 (GRCm39) missense possibly damaging 0.90
R0479:Clca3a2 UTSW 3 144,796,610 (GRCm39) missense probably damaging 1.00
R0542:Clca3a2 UTSW 3 144,781,571 (GRCm39) splice site probably benign
R0629:Clca3a2 UTSW 3 144,778,000 (GRCm39) missense probably benign
R1249:Clca3a2 UTSW 3 144,508,765 (GRCm39) missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144,519,624 (GRCm39) splice site probably benign
R1488:Clca3a2 UTSW 3 144,789,925 (GRCm39) missense possibly damaging 0.49
R1523:Clca3a2 UTSW 3 144,777,405 (GRCm39) nonsense probably null
R1568:Clca3a2 UTSW 3 144,781,410 (GRCm39) nonsense probably null
R1586:Clca3a2 UTSW 3 144,516,477 (GRCm39) missense possibly damaging 0.94
R1650:Clca3a2 UTSW 3 144,797,973 (GRCm39) missense probably damaging 1.00
R1771:Clca3a2 UTSW 3 144,787,171 (GRCm39) missense probably benign 0.12
R1776:Clca3a2 UTSW 3 144,519,681 (GRCm39) missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144,503,398 (GRCm39) missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144,512,164 (GRCm39) missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144,503,398 (GRCm39) missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144,516,457 (GRCm39) missense probably benign
R1923:Clca3a2 UTSW 3 144,511,491 (GRCm39) missense probably damaging 1.00
R2101:Clca3a2 UTSW 3 144,783,699 (GRCm39) missense probably damaging 0.99
R2200:Clca3a2 UTSW 3 144,519,685 (GRCm39) missense probably benign 0.10
R2242:Clca3a2 UTSW 3 144,796,551 (GRCm39) missense probably damaging 0.98
R2324:Clca3a2 UTSW 3 144,512,041 (GRCm39) critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144,519,679 (GRCm39) missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144,512,088 (GRCm39) missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144,514,522 (GRCm39) unclassified probably benign
R3551:Clca3a2 UTSW 3 144,508,842 (GRCm39) missense probably damaging 1.00
R3751:Clca3a2 UTSW 3 144,777,216 (GRCm39) missense probably benign 0.04
R3952:Clca3a2 UTSW 3 144,508,822 (GRCm39) missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144,516,613 (GRCm39) missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144,512,081 (GRCm39) missense probably benign 0.02
R4496:Clca3a2 UTSW 3 144,797,926 (GRCm39) missense possibly damaging 0.94
R4518:Clca3a2 UTSW 3 144,514,466 (GRCm39) missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144,511,444 (GRCm39) missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144,513,112 (GRCm39) missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144,513,112 (GRCm39) missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144,516,613 (GRCm39) missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144,523,692 (GRCm39) missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144,512,263 (GRCm39) missense probably damaging 1.00
R4962:Clca3a2 UTSW 3 144,783,640 (GRCm39) missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144,512,104 (GRCm39) missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144,511,599 (GRCm39) missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144,519,340 (GRCm39) missense probably damaging 1.00
R5344:Clca3a2 UTSW 3 144,793,703 (GRCm39) missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144,503,286 (GRCm39) missense probably benign 0.00
R5424:Clca3a2 UTSW 3 144,789,942 (GRCm39) missense probably damaging 0.99
R5656:Clca3a2 UTSW 3 144,503,393 (GRCm39) missense probably benign 0.26
R5931:Clca3a2 UTSW 3 144,797,886 (GRCm39) missense possibly damaging 0.88
R6059:Clca3a2 UTSW 3 144,516,531 (GRCm39) missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144,525,118 (GRCm39) missense probably damaging 0.99
R6181:Clca3a2 UTSW 3 144,796,469 (GRCm39) nonsense probably null
R6254:Clca3a2 UTSW 3 144,507,895 (GRCm39) missense probably benign
R6336:Clca3a2 UTSW 3 144,512,239 (GRCm39) missense probably benign
R6470:Clca3a2 UTSW 3 144,510,024 (GRCm39) splice site probably null
R6593:Clca3a2 UTSW 3 144,514,338 (GRCm39) critical splice donor site probably null
R6598:Clca3a2 UTSW 3 144,792,246 (GRCm39) nonsense probably null
R6631:Clca3a2 UTSW 3 144,519,405 (GRCm39) missense probably benign
R6826:Clca3a2 UTSW 3 144,523,815 (GRCm39) missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144,512,144 (GRCm39) missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144,514,462 (GRCm39) missense probably damaging 1.00
R7167:Clca3a2 UTSW 3 144,803,545 (GRCm39) missense probably benign 0.40
R7211:Clca3a2 UTSW 3 144,519,775 (GRCm39) missense probably benign 0.00
R7229:Clca3a2 UTSW 3 144,789,869 (GRCm39) missense probably damaging 1.00
R7256:Clca3a2 UTSW 3 144,796,608 (GRCm39) missense probably damaging 0.99
R7324:Clca3a2 UTSW 3 144,514,372 (GRCm39) missense probably damaging 0.99
R7365:Clca3a2 UTSW 3 144,804,545 (GRCm39) missense probably damaging 1.00
R7411:Clca3a2 UTSW 3 144,507,860 (GRCm39) missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144,503,362 (GRCm39) missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144,519,340 (GRCm39) missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144,507,674 (GRCm39) makesense probably null
R7813:Clca3a2 UTSW 3 144,790,726 (GRCm39) missense probably benign 0.26
R7889:Clca3a2 UTSW 3 144,516,574 (GRCm39) nonsense probably null
R7946:Clca3a2 UTSW 3 144,513,075 (GRCm39) critical splice donor site probably null
R7991:Clca3a2 UTSW 3 144,519,756 (GRCm39) missense probably benign 0.00
R8022:Clca3a2 UTSW 3 144,511,527 (GRCm39) missense probably damaging 1.00
R8077:Clca3a2 UTSW 3 144,777,288 (GRCm39) missense possibly damaging 0.56
R8169:Clca3a2 UTSW 3 144,783,653 (GRCm39) missense probably damaging 1.00
R8290:Clca3a2 UTSW 3 144,793,719 (GRCm39) missense possibly damaging 0.93
R8300:Clca3a2 UTSW 3 144,804,692 (GRCm39) missense probably benign 0.00
R8344:Clca3a2 UTSW 3 144,511,703 (GRCm39) critical splice acceptor site probably null
R8350:Clca3a2 UTSW 3 144,783,668 (GRCm39) missense probably benign 0.19
R8367:Clca3a2 UTSW 3 144,523,508 (GRCm39) splice site probably null
R8371:Clca3a2 UTSW 3 144,513,114 (GRCm39) nonsense probably null
R8814:Clca3a2 UTSW 3 144,503,525 (GRCm39) missense probably benign 0.18
R8854:Clca3a2 UTSW 3 144,783,852 (GRCm39) missense possibly damaging 0.94
R8876:Clca3a2 UTSW 3 144,777,360 (GRCm39) missense probably benign 0.00
R8887:Clca3a2 UTSW 3 144,790,810 (GRCm39) nonsense probably null
R9006:Clca3a2 UTSW 3 144,783,789 (GRCm39) missense probably damaging 0.99
R9031:Clca3a2 UTSW 3 144,511,475 (GRCm39) missense probably damaging 1.00
R9093:Clca3a2 UTSW 3 144,781,481 (GRCm39) missense probably benign 0.20
R9190:Clca3a2 UTSW 3 144,796,599 (GRCm39) missense probably benign 0.00
R9201:Clca3a2 UTSW 3 144,519,684 (GRCm39) missense probably benign 0.00
R9209:Clca3a2 UTSW 3 144,778,005 (GRCm39) missense probably benign 0.00
R9261:Clca3a2 UTSW 3 144,525,158 (GRCm39) missense probably benign
R9469:Clca3a2 UTSW 3 144,507,938 (GRCm39) missense probably damaging 1.00
R9501:Clca3a2 UTSW 3 144,777,322 (GRCm39) nonsense probably null
R9515:Clca3a2 UTSW 3 144,508,808 (GRCm39) nonsense probably null
R9569:Clca3a2 UTSW 3 144,513,075 (GRCm39) critical splice donor site probably null
R9664:Clca3a2 UTSW 3 144,503,575 (GRCm39) missense probably damaging 1.00
X0025:Clca3a2 UTSW 3 144,792,265 (GRCm39) missense possibly damaging 0.87
Z1177:Clca3a2 UTSW 3 144,792,212 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTCTGGACTTGAGCAATG -3'
(R):5'- GGGGCCTCCATAATGTTCATG -3'

Sequencing Primer
(F):5'- CCTTCTGGACTTGAGCAATGAAAATG -3'
(R):5'- GCAAAACCTCAATTCTGTAAGTGC -3'
Posted On 2022-11-09