Incidental Mutation 'R9069:Clca3a2'
ID 731363
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Name chloride channel accessory 3A2
Synonyms Clca2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R9069 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144796559-144819494 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 144813686 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929]
AlphaFold Q9EQR4
Predicted Effect probably benign
Transcript: ENSMUST00000029929
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 T A 17: 45,507,597 C103S probably damaging Het
Adamts20 T C 15: 94,338,468 S841G probably benign Het
Add3 T A 19: 53,233,901 V313E possibly damaging Het
Ahr G T 12: 35,512,772 probably benign Het
Ankrd12 T A 17: 66,049,879 M48L probably benign Het
Apaf1 A C 10: 91,023,718 probably null Het
Bank1 T C 3: 136,284,011 H106R probably benign Het
Birc6 A G 17: 74,561,265 probably benign Het
Ccdc170 C T 10: 4,561,016 H692Y possibly damaging Het
Cd93 A G 2: 148,442,151 I425T probably benign Het
Celsr1 A C 15: 86,030,571 L1067R possibly damaging Het
Col14a1 T C 15: 55,388,594 S549P unknown Het
Col6a4 A G 9: 106,074,939 S587P possibly damaging Het
Crebbp C A 16: 4,085,323 M2017I probably benign Het
Crybg1 A C 10: 43,998,107 F1002V probably benign Het
Ctif T C 18: 75,521,387 E356G probably damaging Het
Dbx2 T C 15: 95,632,358 K243E probably damaging Het
Dgkh C T 14: 78,616,517 V394I probably damaging Het
Dnaja4 T A 9: 54,714,354 M321K probably benign Het
Dock9 T C 14: 121,628,912 N593S probably damaging Het
Dot1l T A 10: 80,790,726 S1260R probably damaging Het
Eea1 A T 10: 95,995,648 L200F probably damaging Het
Elp2 T G 18: 24,632,776 F658V probably benign Het
Fbxw15 G A 9: 109,565,400 Q116* probably null Het
Fstl5 A T 3: 76,708,109 N826Y probably damaging Het
Galp T C 7: 6,211,348 S60P possibly damaging Het
Gatsl3 A G 11: 4,220,141 E73G probably benign Het
Gm13103 A G 4: 143,851,775 S202G probably benign Het
Gm4778 A C 3: 94,265,846 S50R possibly damaging Het
Gm7298 G T 6: 121,784,434 M1316I probably benign Het
Gsdmc T C 15: 63,778,053 M330V probably benign Het
Hectd2 T C 19: 36,585,462 F175L probably benign Het
Hmbs A G 9: 44,336,805 I318T possibly damaging Het
Ifi205 T C 1: 174,028,275 D63G probably benign Het
Il10ra T A 9: 45,256,098 Q387L probably damaging Het
Kcnj14 C A 7: 45,819,964 G39V probably benign Het
Kpna1 T C 16: 36,016,011 probably benign Het
Lrp2 A T 2: 69,501,652 D1586E probably damaging Het
Lrrc45 A G 11: 120,717,121 I243V probably benign Het
Lrrc7 T C 3: 158,240,501 K187R probably benign Het
Mamdc4 G T 2: 25,563,359 T1216N probably damaging Het
Map1a A C 2: 121,303,664 K1654Q probably benign Het
Mta2 G A 19: 8,946,740 V195M probably damaging Het
Nav2 G T 7: 49,558,813 R1583L probably damaging Het
Olfr1217 A T 2: 89,023,964 L13Q probably damaging Het
Olfr1393 A T 11: 49,280,420 T91S probably benign Het
Olfr1499 T C 19: 13,815,371 Y73C probably damaging Het
Osbpl1a T A 18: 12,869,017 probably benign Het
Pcdh17 T C 14: 84,447,644 V517A possibly damaging Het
Pcdhb14 T A 18: 37,450,104 C754* probably null Het
Pkd1 T C 17: 24,573,014 V1225A probably damaging Het
Plekhm3 T C 1: 64,921,643 N485D probably benign Het
Plekho1 A C 3: 95,995,683 S14A unknown Het
Ppp2r3a A T 9: 101,212,807 C106S probably benign Het
Ppp6c A C 2: 39,204,916 L99R probably damaging Het
Prkdc T A 16: 15,835,227 Y3855* probably null Het
Ptpru A T 4: 131,776,254 I1155N possibly damaging Het
Reln C T 5: 22,011,061 G1042D probably damaging Het
Sall4 A G 2: 168,754,853 V689A probably benign Het
Sec31b C T 19: 44,519,302 G768S probably damaging Het
Serpinb10 T A 1: 107,546,819 V237D probably benign Het
Serpinb9 T G 13: 33,015,596 D291E probably benign Het
Slc12a7 T G 13: 73,805,970 probably benign Het
Slfn8 A T 11: 83,017,076 F214I probably damaging Het
Slu7 A T 11: 43,438,125 D58V probably damaging Het
Smu1 T C 4: 40,745,558 Y254C probably damaging Het
Snapc4 A T 2: 26,370,793 Y479* probably null Het
Specc1l A G 10: 75,230,806 N30D probably benign Het
Tbck T C 3: 132,722,369 probably null Het
Tcf7l1 T C 6: 72,633,276 Y246C probably damaging Het
Tmem43 C T 6: 91,486,915 R391W possibly damaging Het
Trav7-1 T G 14: 52,655,109 S40A possibly damaging Het
Trim45 T A 3: 100,925,124 Y224* probably null Het
Trio A T 15: 27,852,011 I798N possibly damaging Het
Trnau1ap A T 4: 132,329,351 probably null Het
Vmn1r213 T C 13: 23,011,873 S209P probably damaging Het
Ythdf1 G T 2: 180,911,064 R453S probably damaging Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Clca3a2 APN 3 144813627 nonsense probably null
IGL01663:Clca3a2 APN 3 144817155 missense probably damaging 0.97
IGL01779:Clca3a2 APN 3 144819378 missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144813455 missense probably benign
IGL02301:Clca3a2 APN 3 144806372 missense probably damaging 0.98
IGL02619:Clca3a2 APN 3 144806322 missense probably damaging 1.00
IGL02852:Clca3a2 APN 3 144806343 missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144816768 missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144806416 missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144816733 missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144813898 missense possibly damaging 0.90
R1249:Clca3a2 UTSW 3 144803004 missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144813863 splice site probably benign
R1586:Clca3a2 UTSW 3 144810716 missense possibly damaging 0.94
R1776:Clca3a2 UTSW 3 144813920 missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144806403 missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144810696 missense probably benign
R1923:Clca3a2 UTSW 3 144805730 missense probably damaging 1.00
R2200:Clca3a2 UTSW 3 144813924 missense probably benign 0.10
R2324:Clca3a2 UTSW 3 144806280 critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144813918 missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144806327 missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144808761 unclassified probably benign
R3551:Clca3a2 UTSW 3 144803081 missense probably damaging 1.00
R3952:Clca3a2 UTSW 3 144803061 missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144806320 missense probably benign 0.02
R4518:Clca3a2 UTSW 3 144808705 missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144805683 missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144817931 missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144806502 missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144806343 missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144805838 missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144797525 missense probably benign 0.00
R5656:Clca3a2 UTSW 3 144797632 missense probably benign 0.26
R6059:Clca3a2 UTSW 3 144810770 missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144819357 missense probably damaging 0.99
R6254:Clca3a2 UTSW 3 144802134 missense probably benign
R6336:Clca3a2 UTSW 3 144806478 missense probably benign
R6470:Clca3a2 UTSW 3 144804263 splice site probably null
R6593:Clca3a2 UTSW 3 144808577 critical splice donor site probably null
R6631:Clca3a2 UTSW 3 144813644 missense probably benign
R6826:Clca3a2 UTSW 3 144818054 missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144806383 missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144808701 missense probably damaging 1.00
R7211:Clca3a2 UTSW 3 144814014 missense probably benign 0.00
R7324:Clca3a2 UTSW 3 144808611 missense probably damaging 0.99
R7411:Clca3a2 UTSW 3 144802099 missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144797601 missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144801913 makesense probably null
R7889:Clca3a2 UTSW 3 144810813 nonsense probably null
R7946:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
R7991:Clca3a2 UTSW 3 144813995 missense probably benign 0.00
R8022:Clca3a2 UTSW 3 144805766 missense probably damaging 1.00
R8344:Clca3a2 UTSW 3 144805942 critical splice acceptor site probably null
R8367:Clca3a2 UTSW 3 144817747 splice site probably null
R8371:Clca3a2 UTSW 3 144807353 nonsense probably null
R8814:Clca3a2 UTSW 3 144797764 missense probably benign 0.18
R9031:Clca3a2 UTSW 3 144805714 missense probably damaging 1.00
R9201:Clca3a2 UTSW 3 144813923 missense probably benign 0.00
R9261:Clca3a2 UTSW 3 144819397 missense probably benign
R9469:Clca3a2 UTSW 3 144802177 missense probably damaging 1.00
R9515:Clca3a2 UTSW 3 144803047 nonsense probably null
R9569:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
R9664:Clca3a2 UTSW 3 144797814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTCTGGACTTGAGCAATG -3'
(R):5'- GGGGCCTCCATAATGTTCATG -3'

Sequencing Primer
(F):5'- CCTTCTGGACTTGAGCAATGAAAATG -3'
(R):5'- GCAAAACCTCAATTCTGTAAGTGC -3'
Posted On 2022-11-09