Incidental Mutation 'R9733:Plekho1'
ID 731530
Institutional Source Beutler Lab
Gene Symbol Plekho1
Ensembl Gene ENSMUSG00000015745
Gene Name pleckstrin homology domain containing, family O member 1
Synonyms JZA-20, Jza2, 2810052M02Rik, CKIP-1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R9733 (G1)
Quality Score 105.008
Status Not validated
Chromosome 3
Chromosomal Location 95988429-95996001 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 95995779 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 7 (G7S)
Ref Sequence ENSEMBL: ENSMUSP00000015889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015889] [ENSMUST00000015891] [ENSMUST00000123006] [ENSMUST00000130043] [ENSMUST00000143485]
AlphaFold Q9JIY0
Predicted Effect probably benign
Transcript: ENSMUST00000015889
AA Change: G7S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015889
Gene: ENSMUSG00000015745
AA Change: G7S

DomainStartEndE-ValueType
PH 21 133 2.68e-14 SMART
PDB:3AA1|C 147 169 2e-8 PDB
low complexity region 337 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000015891
SMART Domains Protein: ENSMUSP00000015891
Gene: ENSMUSG00000015747

DomainStartEndE-ValueType
Pfam:Sec1 23 546 3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123006
SMART Domains Protein: ENSMUSP00000118665
Gene: ENSMUSG00000015745

DomainStartEndE-ValueType
PH 12 124 2.68e-14 SMART
low complexity region 294 306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130043
SMART Domains Protein: ENSMUSP00000115035
Gene: ENSMUSG00000015745

DomainStartEndE-ValueType
low complexity region 7 15 N/A INTRINSIC
PH 30 142 2.68e-14 SMART
PDB:3AA1|C 156 178 2e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000143485
AA Change: G7S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114505
Gene: ENSMUSG00000015745
AA Change: G7S

DomainStartEndE-ValueType
PH 13 124 1.08e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit age-dependent increase in bone volume and increased osteoblast activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik C T 14: 4,334,795 probably benign Het
4930595D18Rik T A 12: 111,161,820 probably benign Het
4932438A13Rik T A 3: 37,048,583 M1437K Het
Alpi C T 1: 87,100,794 A125T probably benign Het
Alppl2 T A 1: 87,087,235 H468L probably damaging Het
Arhgef12 A T 9: 42,989,998 L836* probably null Het
Arv1 T C 8: 124,731,919 Y261H probably damaging Het
Atf6 C T 1: 170,834,833 S286N probably benign Het
Atl3 G A 19: 7,532,340 G478R probably damaging Het
Avil C T 10: 127,007,842 R184C probably damaging Het
B020004J07Rik A G 4: 101,835,768 V345A possibly damaging Het
Bcl6b A G 11: 70,228,497 I131T probably damaging Het
Catsper3 T C 13: 55,798,939 S150P probably damaging Het
Cd7 A G 11: 121,037,811 S132P probably benign Het
Cfh T C 1: 140,088,795 D1142G probably damaging Het
Clca4b T G 3: 144,915,511 K601Q probably benign Het
Cp A G 3: 19,978,962 H651R probably damaging Het
Cyp2s1 T A 7: 25,808,104 T307S probably damaging Het
Dcaf11 A G 14: 55,565,713 D328G probably damaging Het
Eapp A T 12: 54,692,956 S25R probably damaging Het
Ebag9 T A 15: 44,627,637 probably null Het
Exog G A 9: 119,462,520 E288K possibly damaging Het
Fads2 A T 19: 10,070,576 Y265N probably damaging Het
Fam234b T A 6: 135,217,010 S220R possibly damaging Het
Fcgbp T A 7: 28,103,587 C1539S probably damaging Het
Fuk T C 8: 110,888,931 T589A probably benign Het
Fv1 C T 4: 147,870,164 R396W probably damaging Het
Fv1 T C 4: 147,870,197 F407L probably benign Het
Glp2r T C 11: 67,757,541 T112A probably benign Het
Gm5346 T C 8: 43,626,149 N346S possibly damaging Het
Hydin T C 8: 110,535,379 I2704T probably benign Het
Ighm T A 12: 113,422,477 E84D probably benign Het
Ikzf5 A G 7: 131,392,283 V205A probably benign Het
Kcnt1 G T 2: 25,907,339 V844L probably benign Het
Kif2a A C 13: 106,969,796 S528R probably damaging Het
Klhl29 G A 12: 5,140,641 T118M probably damaging Het
Krt4 C A 15: 101,919,129 G492C unknown Het
Lama1 T A 17: 67,809,945 I2441N Het
Lin7a T C 10: 107,412,044 V192A possibly damaging Het
March8 T A 6: 116,402,029 V308D probably damaging Het
Mgat5b T C 11: 116,947,248 S238P possibly damaging Het
Mrps25 A G 6: 92,178,734 S73P probably damaging Het
Muc6 G T 7: 141,636,397 P2788T unknown Het
Ncf1 T C 5: 134,222,045 T347A probably benign Het
Ndufaf4 T C 4: 24,903,177 M122T probably benign Het
Nfil3 C T 13: 52,967,555 A438T probably damaging Het
Noc2l T G 4: 156,243,565 I504S probably damaging Het
Nphs1 T C 7: 30,467,530 C735R probably damaging Het
Olfr1166 C A 2: 88,124,656 V110L probably damaging Het
Olfr1380 T C 11: 49,564,134 L71P probably damaging Het
Olfr6 A C 7: 106,956,639 L99R possibly damaging Het
Olfr981 A T 9: 40,022,875 S161C probably benign Het
Pcdhac1 A G 18: 37,092,453 H773R probably benign Het
Pcnt A G 10: 76,401,480 V1324A probably benign Het
Pcsk4 T C 10: 80,322,200 Y568C probably damaging Het
Pdlim1 A T 19: 40,230,596 M197K probably damaging Het
Prl7d1 A C 13: 27,714,356 S57A probably benign Het
Prpf3 A G 3: 95,834,200 V548A possibly damaging Het
Prss56 C T 1: 87,183,497 P2L possibly damaging Het
Ric1 A G 19: 29,602,630 D1277G possibly damaging Het
Rnf19b T A 4: 129,084,019 D676E probably damaging Het
Rph3a T A 5: 120,962,458 T126S probably benign Het
Sh3gl3 T C 7: 82,268,354 probably null Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc35f2 T C 9: 53,801,101 V126A probably benign Het
Snrnp200 A T 2: 127,226,320 Q860L probably damaging Het
Srbd1 T C 17: 86,115,283 N435S probably damaging Het
Tab2 A G 10: 7,919,450 S349P possibly damaging Het
Tie1 A T 4: 118,472,986 W1040R probably null Het
Tnni3k A T 3: 154,856,607 Y678N probably damaging Het
Trav12-3 T C 14: 53,622,017 V40A possibly damaging Het
Ttn G A 2: 76,746,035 S24838L probably damaging Het
Ttn A G 2: 76,895,316 W6158R unknown Het
Vegfa T C 17: 46,024,475 S298G probably damaging Het
Zer1 T C 2: 30,107,631 K421R probably benign Het
Zfp959 C A 17: 55,897,866 T301N probably benign Het
Other mutations in Plekho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Plekho1 APN 3 95990835 missense probably damaging 1.00
IGL02198:Plekho1 APN 3 95992184 missense probably damaging 1.00
IGL02395:Plekho1 APN 3 95995564 nonsense probably null
IGL02898:Plekho1 APN 3 95992181 missense probably damaging 1.00
IGL02970:Plekho1 APN 3 95990902 missense probably damaging 1.00
R1474:Plekho1 UTSW 3 95989566 missense probably damaging 1.00
R2131:Plekho1 UTSW 3 95989117 missense probably damaging 1.00
R2437:Plekho1 UTSW 3 95992185 missense probably damaging 1.00
R4698:Plekho1 UTSW 3 95995652 missense possibly damaging 0.83
R4860:Plekho1 UTSW 3 95988993 missense possibly damaging 0.68
R4860:Plekho1 UTSW 3 95988993 missense possibly damaging 0.68
R5020:Plekho1 UTSW 3 95989539 missense probably damaging 0.99
R5237:Plekho1 UTSW 3 95995625 missense probably damaging 1.00
R6528:Plekho1 UTSW 3 95989321 missense probably damaging 1.00
R7571:Plekho1 UTSW 3 95989254 missense probably damaging 0.97
R9069:Plekho1 UTSW 3 95995683 missense unknown
Z1176:Plekho1 UTSW 3 95995715 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTCCCGCAGAATTTCCGGAC -3'
(R):5'- CACAGGACTCAGAAGAGCTC -3'

Sequencing Primer
(F):5'- GCAGAATTTCCGGACCCAGC -3'
(R):5'- TGCACGCGTGTTTACCG -3'
Posted On 2022-11-14