Incidental Mutation 'R9733:Nphs1'
ID 731547
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9733 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30458315-30487223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30467530 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 735 (C735R)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably damaging
Transcript: ENSMUST00000006825
AA Change: C735R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: C735R

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126297
AA Change: C721R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: C721R

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik C T 14: 4,334,795 probably benign Het
4930595D18Rik T A 12: 111,161,820 probably benign Het
4932438A13Rik T A 3: 37,048,583 M1437K Het
Alpi C T 1: 87,100,794 A125T probably benign Het
Alppl2 T A 1: 87,087,235 H468L probably damaging Het
Arhgef12 A T 9: 42,989,998 L836* probably null Het
Arv1 T C 8: 124,731,919 Y261H probably damaging Het
Atf6 C T 1: 170,834,833 S286N probably benign Het
Atl3 G A 19: 7,532,340 G478R probably damaging Het
Avil C T 10: 127,007,842 R184C probably damaging Het
B020004J07Rik A G 4: 101,835,768 V345A possibly damaging Het
Bcl6b A G 11: 70,228,497 I131T probably damaging Het
Catsper3 T C 13: 55,798,939 S150P probably damaging Het
Cd7 A G 11: 121,037,811 S132P probably benign Het
Cfh T C 1: 140,088,795 D1142G probably damaging Het
Clca4b T G 3: 144,915,511 K601Q probably benign Het
Cp A G 3: 19,978,962 H651R probably damaging Het
Cyp2s1 T A 7: 25,808,104 T307S probably damaging Het
Dcaf11 A G 14: 55,565,713 D328G probably damaging Het
Eapp A T 12: 54,692,956 S25R probably damaging Het
Ebag9 T A 15: 44,627,637 probably null Het
Exog G A 9: 119,462,520 E288K possibly damaging Het
Fads2 A T 19: 10,070,576 Y265N probably damaging Het
Fam234b T A 6: 135,217,010 S220R possibly damaging Het
Fcgbp T A 7: 28,103,587 C1539S probably damaging Het
Fuk T C 8: 110,888,931 T589A probably benign Het
Fv1 C T 4: 147,870,164 R396W probably damaging Het
Fv1 T C 4: 147,870,197 F407L probably benign Het
Glp2r T C 11: 67,757,541 T112A probably benign Het
Gm5346 T C 8: 43,626,149 N346S possibly damaging Het
Hydin T C 8: 110,535,379 I2704T probably benign Het
Ighm T A 12: 113,422,477 E84D probably benign Het
Ikzf5 A G 7: 131,392,283 V205A probably benign Het
Kcnt1 G T 2: 25,907,339 V844L probably benign Het
Kif2a A C 13: 106,969,796 S528R probably damaging Het
Klhl29 G A 12: 5,140,641 T118M probably damaging Het
Krt4 C A 15: 101,919,129 G492C unknown Het
Lama1 T A 17: 67,809,945 I2441N Het
Lin7a T C 10: 107,412,044 V192A possibly damaging Het
March8 T A 6: 116,402,029 V308D probably damaging Het
Mgat5b T C 11: 116,947,248 S238P possibly damaging Het
Mrps25 A G 6: 92,178,734 S73P probably damaging Het
Muc6 G T 7: 141,636,397 P2788T unknown Het
Ncf1 T C 5: 134,222,045 T347A probably benign Het
Ndufaf4 T C 4: 24,903,177 M122T probably benign Het
Nfil3 C T 13: 52,967,555 A438T probably damaging Het
Noc2l T G 4: 156,243,565 I504S probably damaging Het
Olfr1166 C A 2: 88,124,656 V110L probably damaging Het
Olfr1380 T C 11: 49,564,134 L71P probably damaging Het
Olfr6 A C 7: 106,956,639 L99R possibly damaging Het
Olfr981 A T 9: 40,022,875 S161C probably benign Het
Pcdhac1 A G 18: 37,092,453 H773R probably benign Het
Pcnt A G 10: 76,401,480 V1324A probably benign Het
Pcsk4 T C 10: 80,322,200 Y568C probably damaging Het
Pdlim1 A T 19: 40,230,596 M197K probably damaging Het
Plekho1 C T 3: 95,995,779 G7S probably benign Het
Prl7d1 A C 13: 27,714,356 S57A probably benign Het
Prpf3 A G 3: 95,834,200 V548A possibly damaging Het
Prss56 C T 1: 87,183,497 P2L possibly damaging Het
Ric1 A G 19: 29,602,630 D1277G possibly damaging Het
Rnf19b T A 4: 129,084,019 D676E probably damaging Het
Rph3a T A 5: 120,962,458 T126S probably benign Het
Sh3gl3 T C 7: 82,268,354 probably null Het
Slc14a1 C A 18: 78,109,592 A367S probably damaging Het
Slc35f2 T C 9: 53,801,101 V126A probably benign Het
Snrnp200 A T 2: 127,226,320 Q860L probably damaging Het
Srbd1 T C 17: 86,115,283 N435S probably damaging Het
Tab2 A G 10: 7,919,450 S349P possibly damaging Het
Tie1 A T 4: 118,472,986 W1040R probably null Het
Tnni3k A T 3: 154,856,607 Y678N probably damaging Het
Trav12-3 T C 14: 53,622,017 V40A possibly damaging Het
Ttn G A 2: 76,746,035 S24838L probably damaging Het
Ttn A G 2: 76,895,316 W6158R unknown Het
Vegfa T C 17: 46,024,475 S298G probably damaging Het
Zer1 T C 2: 30,107,631 K421R probably benign Het
Zfp959 C A 17: 55,897,866 T301N probably benign Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30482053 missense probably benign 0.02
R8485:Nphs1 UTSW 7 30466173 missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30463859 missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30462655 missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30463200 missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30460667 nonsense probably null
R9159:Nphs1 UTSW 7 30465601 missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30471169 missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9548:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9607:Nphs1 UTSW 7 30463587 missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30467566 missense probably benign 0.16
R9720:Nphs1 UTSW 7 30466074 missense possibly damaging 0.83
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30460350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAACTGGACCTTCCGAG -3'
(R):5'- AGCCTGTCTTCATCGTTGTG -3'

Sequencing Primer
(F):5'- GCCTCAGCCCAGGTAGGATG -3'
(R):5'- CATCGTTGTGCCTCTGTGATTATTAG -3'
Posted On 2022-11-14