Incidental Mutation 'R9733:Adam34l'
ID 731552
Institutional Source Beutler Lab
Gene Symbol Adam34l
Ensembl Gene ENSMUSG00000050190
Gene Name a disintegrin and metallopeptidase domain 34 like
Synonyms Gm5346
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R9733 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 44077988-44080313 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44079186 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 346 (N346S)
Ref Sequence ENSEMBL: ENSMUSP00000058858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056023]
AlphaFold Q7M766
Predicted Effect possibly damaging
Transcript: ENSMUST00000056023
AA Change: N346S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058858
Gene: ENSMUSG00000050190
AA Change: N346S

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 159 1.3e-18 PFAM
Pfam:Reprolysin_5 205 384 1.1e-15 PFAM
Pfam:Reprolysin_4 205 393 6.2e-9 PFAM
Pfam:Reprolysin 207 397 1.7e-46 PFAM
Pfam:Reprolysin_2 223 389 5.7e-14 PFAM
Pfam:Reprolysin_3 231 352 2.6e-13 PFAM
DISIN 416 491 2.48e-38 SMART
ACR 492 628 3.4e-65 SMART
EGF 634 664 2.69e1 SMART
transmembrane domain 685 707 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik C T 14: 15,712,825 (GRCm39) probably benign Het
4930595D18Rik T A 12: 111,128,254 (GRCm39) probably benign Het
Alpi C T 1: 87,028,516 (GRCm39) A125T probably benign Het
Alppl2 T A 1: 87,014,957 (GRCm39) H468L probably damaging Het
Arhgef12 A T 9: 42,901,294 (GRCm39) L836* probably null Het
Arv1 T C 8: 125,458,658 (GRCm39) Y261H probably damaging Het
Atf6 C T 1: 170,662,402 (GRCm39) S286N probably benign Het
Atl3 G A 19: 7,509,705 (GRCm39) G478R probably damaging Het
Avil C T 10: 126,843,711 (GRCm39) R184C probably damaging Het
Bcl6b A G 11: 70,119,323 (GRCm39) I131T probably damaging Het
Bltp1 T A 3: 37,102,732 (GRCm39) M1437K Het
Catsper3 T C 13: 55,946,752 (GRCm39) S150P probably damaging Het
Cd7 A G 11: 120,928,637 (GRCm39) S132P probably benign Het
Cfh T C 1: 140,016,533 (GRCm39) D1142G probably damaging Het
Clca4b T G 3: 144,621,272 (GRCm39) K601Q probably benign Het
Cp A G 3: 20,033,126 (GRCm39) H651R probably damaging Het
Cyp2s1 T A 7: 25,507,529 (GRCm39) T307S probably damaging Het
Dcaf11 A G 14: 55,803,170 (GRCm39) D328G probably damaging Het
Eapp A T 12: 54,739,741 (GRCm39) S25R probably damaging Het
Ebag9 T A 15: 44,491,033 (GRCm39) probably null Het
Exog G A 9: 119,291,586 (GRCm39) E288K possibly damaging Het
Fads2 A T 19: 10,047,940 (GRCm39) Y265N probably damaging Het
Fam234b T A 6: 135,194,008 (GRCm39) S220R possibly damaging Het
Fcgbp T A 7: 27,803,012 (GRCm39) C1539S probably damaging Het
Fcsk T C 8: 111,615,563 (GRCm39) T589A probably benign Het
Fv1 C T 4: 147,954,621 (GRCm39) R396W probably damaging Het
Fv1 T C 4: 147,954,654 (GRCm39) F407L probably benign Het
Glp2r T C 11: 67,648,367 (GRCm39) T112A probably benign Het
Hydin T C 8: 111,262,011 (GRCm39) I2704T probably benign Het
Ighm T A 12: 113,386,097 (GRCm39) E84D probably benign Het
Ikzf5 A G 7: 130,994,012 (GRCm39) V205A probably benign Het
Kcnt1 G T 2: 25,797,351 (GRCm39) V844L probably benign Het
Kif2a A C 13: 107,106,304 (GRCm39) S528R probably damaging Het
Klhl29 G A 12: 5,190,641 (GRCm39) T118M probably damaging Het
Krt4 C A 15: 101,827,564 (GRCm39) G492C unknown Het
Lama1 T A 17: 68,116,940 (GRCm39) I2441N Het
Lin7a T C 10: 107,247,905 (GRCm39) V192A possibly damaging Het
Marchf8 T A 6: 116,378,990 (GRCm39) V308D probably damaging Het
Mgat5b T C 11: 116,838,074 (GRCm39) S238P possibly damaging Het
Mrps25 A G 6: 92,155,715 (GRCm39) S73P probably damaging Het
Muc6 G T 7: 141,216,310 (GRCm39) P2788T unknown Het
Ncf1 T C 5: 134,250,899 (GRCm39) T347A probably benign Het
Ndufaf4 T C 4: 24,903,177 (GRCm39) M122T probably benign Het
Nfil3 C T 13: 53,121,591 (GRCm39) A438T probably damaging Het
Noc2l T G 4: 156,328,022 (GRCm39) I504S probably damaging Het
Nphs1 T C 7: 30,166,955 (GRCm39) C735R probably damaging Het
Or10g6 A T 9: 39,934,171 (GRCm39) S161C probably benign Het
Or2y10 T C 11: 49,454,961 (GRCm39) L71P probably damaging Het
Or5d38 C A 2: 87,955,000 (GRCm39) V110L probably damaging Het
Or6b9 A C 7: 106,555,846 (GRCm39) L99R possibly damaging Het
Pcdhac1 A G 18: 37,225,506 (GRCm39) H773R probably benign Het
Pcnt A G 10: 76,237,314 (GRCm39) V1324A probably benign Het
Pcsk4 T C 10: 80,158,034 (GRCm39) Y568C probably damaging Het
Pdlim1 A T 19: 40,219,040 (GRCm39) M197K probably damaging Het
Plekho1 C T 3: 95,903,091 (GRCm39) G7S probably benign Het
Pramel17 A G 4: 101,692,965 (GRCm39) V345A possibly damaging Het
Prl7d1 A C 13: 27,898,339 (GRCm39) S57A probably benign Het
Prpf3 A G 3: 95,741,512 (GRCm39) V548A possibly damaging Het
Prss56 C T 1: 87,111,219 (GRCm39) P2L possibly damaging Het
Ric1 A G 19: 29,580,030 (GRCm39) D1277G possibly damaging Het
Rnf19b T A 4: 128,977,812 (GRCm39) D676E probably damaging Het
Rph3a T A 5: 121,100,521 (GRCm39) T126S probably benign Het
Sh3gl3 T C 7: 81,917,562 (GRCm39) probably null Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc35f2 T C 9: 53,708,385 (GRCm39) V126A probably benign Het
Snrnp200 A T 2: 127,068,240 (GRCm39) Q860L probably damaging Het
Srbd1 T C 17: 86,422,711 (GRCm39) N435S probably damaging Het
Tab2 A G 10: 7,795,214 (GRCm39) S349P possibly damaging Het
Tie1 A T 4: 118,330,183 (GRCm39) W1040R probably null Het
Tnni3k A T 3: 154,562,244 (GRCm39) Y678N probably damaging Het
Trav12-3 T C 14: 53,859,474 (GRCm39) V40A possibly damaging Het
Ttn G A 2: 76,576,379 (GRCm39) S24838L probably damaging Het
Ttn A G 2: 76,725,660 (GRCm39) W6158R unknown Het
Vegfa T C 17: 46,335,401 (GRCm39) S298G probably damaging Het
Zer1 T C 2: 29,997,643 (GRCm39) K421R probably benign Het
Zfp959 C A 17: 56,204,866 (GRCm39) T301N probably benign Het
Other mutations in Adam34l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Adam34l APN 8 44,078,418 (GRCm39) missense probably benign 0.12
IGL00391:Adam34l APN 8 44,078,666 (GRCm39) missense probably damaging 1.00
IGL00422:Adam34l APN 8 44,079,388 (GRCm39) missense probably damaging 1.00
IGL00664:Adam34l APN 8 44,079,006 (GRCm39) missense probably benign
IGL01095:Adam34l APN 8 44,079,133 (GRCm39) missense probably benign 0.22
IGL01113:Adam34l APN 8 44,079,189 (GRCm39) missense probably damaging 1.00
IGL01444:Adam34l APN 8 44,079,470 (GRCm39) missense probably benign 0.06
IGL01782:Adam34l APN 8 44,079,772 (GRCm39) missense probably benign 0.01
IGL01921:Adam34l APN 8 44,078,548 (GRCm39) missense probably damaging 0.96
IGL01964:Adam34l APN 8 44,079,798 (GRCm39) missense probably benign 0.00
IGL02139:Adam34l APN 8 44,078,615 (GRCm39) missense probably benign 0.01
IGL02555:Adam34l APN 8 44,078,305 (GRCm39) missense probably damaging 1.00
IGL02951:Adam34l APN 8 44,080,125 (GRCm39) missense possibly damaging 0.62
R0056:Adam34l UTSW 8 44,078,540 (GRCm39) nonsense probably null
R0218:Adam34l UTSW 8 44,079,477 (GRCm39) missense probably benign 0.00
R0530:Adam34l UTSW 8 44,079,568 (GRCm39) missense probably benign 0.00
R0925:Adam34l UTSW 8 44,079,340 (GRCm39) missense probably benign 0.11
R0927:Adam34l UTSW 8 44,078,160 (GRCm39) missense probably benign 0.00
R0975:Adam34l UTSW 8 44,078,155 (GRCm39) missense probably benign
R1300:Adam34l UTSW 8 44,079,881 (GRCm39) nonsense probably null
R1728:Adam34l UTSW 8 44,078,620 (GRCm39) missense probably damaging 1.00
R1729:Adam34l UTSW 8 44,078,620 (GRCm39) missense probably damaging 1.00
R1801:Adam34l UTSW 8 44,078,954 (GRCm39) nonsense probably null
R1869:Adam34l UTSW 8 44,078,132 (GRCm39) nonsense probably null
R1870:Adam34l UTSW 8 44,078,132 (GRCm39) nonsense probably null
R1871:Adam34l UTSW 8 44,078,132 (GRCm39) nonsense probably null
R1992:Adam34l UTSW 8 44,080,176 (GRCm39) missense probably benign 0.44
R2008:Adam34l UTSW 8 44,080,074 (GRCm39) missense probably benign 0.00
R2013:Adam34l UTSW 8 44,079,442 (GRCm39) missense possibly damaging 0.81
R2022:Adam34l UTSW 8 44,078,954 (GRCm39) nonsense probably null
R2175:Adam34l UTSW 8 44,078,475 (GRCm39) missense probably benign
R2875:Adam34l UTSW 8 44,080,177 (GRCm39) nonsense probably null
R3406:Adam34l UTSW 8 44,079,089 (GRCm39) nonsense probably null
R3845:Adam34l UTSW 8 44,079,669 (GRCm39) missense probably benign 0.00
R4033:Adam34l UTSW 8 44,079,710 (GRCm39) missense probably benign 0.28
R4072:Adam34l UTSW 8 44,079,387 (GRCm39) missense probably damaging 1.00
R4074:Adam34l UTSW 8 44,079,387 (GRCm39) missense probably damaging 1.00
R4075:Adam34l UTSW 8 44,079,387 (GRCm39) missense probably damaging 1.00
R4076:Adam34l UTSW 8 44,079,387 (GRCm39) missense probably damaging 1.00
R4153:Adam34l UTSW 8 44,079,564 (GRCm39) missense probably benign 0.04
R4330:Adam34l UTSW 8 44,079,287 (GRCm39) missense probably benign
R4612:Adam34l UTSW 8 44,079,587 (GRCm39) missense probably benign 0.09
R4662:Adam34l UTSW 8 44,080,116 (GRCm39) missense probably benign 0.26
R5032:Adam34l UTSW 8 44,079,508 (GRCm39) missense probably damaging 1.00
R5077:Adam34l UTSW 8 44,080,200 (GRCm39) missense possibly damaging 0.79
R5504:Adam34l UTSW 8 44,078,319 (GRCm39) missense probably damaging 1.00
R5697:Adam34l UTSW 8 44,079,616 (GRCm39) missense probably damaging 1.00
R6232:Adam34l UTSW 8 44,078,949 (GRCm39) missense probably benign 0.00
R6233:Adam34l UTSW 8 44,078,949 (GRCm39) missense probably benign 0.00
R6234:Adam34l UTSW 8 44,078,949 (GRCm39) missense probably benign 0.00
R6235:Adam34l UTSW 8 44,078,949 (GRCm39) missense probably benign 0.00
R6241:Adam34l UTSW 8 44,079,133 (GRCm39) missense probably benign 0.22
R6392:Adam34l UTSW 8 44,079,038 (GRCm39) missense probably benign 0.09
R6439:Adam34l UTSW 8 44,078,988 (GRCm39) missense probably damaging 1.00
R6454:Adam34l UTSW 8 44,079,845 (GRCm39) missense probably damaging 0.96
R6455:Adam34l UTSW 8 44,079,189 (GRCm39) missense probably damaging 1.00
R6767:Adam34l UTSW 8 44,079,951 (GRCm39) missense probably damaging 1.00
R6774:Adam34l UTSW 8 44,078,220 (GRCm39) missense probably benign 0.00
R6877:Adam34l UTSW 8 44,078,274 (GRCm39) missense probably benign 0.02
R6911:Adam34l UTSW 8 44,078,146 (GRCm39) missense probably benign 0.02
R7211:Adam34l UTSW 8 44,078,914 (GRCm39) missense probably damaging 1.00
R7597:Adam34l UTSW 8 44,078,281 (GRCm39) missense probably damaging 1.00
R7602:Adam34l UTSW 8 44,079,703 (GRCm39) missense probably damaging 0.99
R7797:Adam34l UTSW 8 44,079,411 (GRCm39) missense probably benign 0.04
R7981:Adam34l UTSW 8 44,078,850 (GRCm39) missense probably damaging 1.00
R8154:Adam34l UTSW 8 44,078,424 (GRCm39) missense probably damaging 0.97
R8215:Adam34l UTSW 8 44,079,538 (GRCm39) missense probably benign 0.05
R9180:Adam34l UTSW 8 44,079,970 (GRCm39) nonsense probably null
R9307:Adam34l UTSW 8 44,079,304 (GRCm39) missense probably benign 0.00
RF001:Adam34l UTSW 8 44,079,942 (GRCm39) missense possibly damaging 0.79
Z1177:Adam34l UTSW 8 44,079,583 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCAAGTTATTGCCACACATG -3'
(R):5'- AAATGTCAGCGGCCCTAGATG -3'

Sequencing Primer
(F):5'- CACACATGGTCGGCACC -3'
(R):5'- CGGCCCTAGATGCATTCTGTAG -3'
Posted On 2022-11-14