Incidental Mutation 'R9733:Hydin'
ID 731553
Institutional Source Beutler Lab
Gene Symbol Hydin
Ensembl Gene ENSMUSG00000059854
Gene Name HYDIN, axonemal central pair apparatus protein
Synonyms 1700034M11Rik, 4930545D19Rik, hy3, hyrh, hy-3
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.757) question?
Stock # R9733 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 110993609-111336885 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 111262011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 2704 (I2704T)
Ref Sequence ENSEMBL: ENSMUSP00000046204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043141]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000043141
AA Change: I2704T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046204
Gene: ENSMUSG00000059854
AA Change: I2704T

DomainStartEndE-ValueType
Pfam:Motile_Sperm 246 325 5.6e-8 PFAM
Pfam:ASH 559 659 9.4e-17 PFAM
low complexity region 788 798 N/A INTRINSIC
Pfam:PapD-like 848 906 1.2e-6 PFAM
low complexity region 998 1024 N/A INTRINSIC
low complexity region 1279 1292 N/A INTRINSIC
internal_repeat_6 1317 1549 5.96e-5 PROSPERO
internal_repeat_5 1355 1502 3.23e-5 PROSPERO
low complexity region 1574 1590 N/A INTRINSIC
internal_repeat_4 1712 1940 5.14e-6 PROSPERO
coiled coil region 1947 1977 N/A INTRINSIC
low complexity region 2009 2020 N/A INTRINSIC
low complexity region 2034 2049 N/A INTRINSIC
SCOP:d1eq1a_ 2305 2403 3e-4 SMART
low complexity region 2404 2419 N/A INTRINSIC
coiled coil region 2543 2588 N/A INTRINSIC
low complexity region 2636 2656 N/A INTRINSIC
internal_repeat_7 2772 3008 8.1e-5 PROSPERO
low complexity region 3660 3670 N/A INTRINSIC
low complexity region 3919 3934 N/A INTRINSIC
internal_repeat_5 4046 4190 3.23e-5 PROSPERO
internal_repeat_2 4106 4251 6.03e-7 PROSPERO
internal_repeat_4 4317 4532 5.14e-6 PROSPERO
internal_repeat_3 4403 4689 2.05e-6 PROSPERO
internal_repeat_2 4549 4697 6.03e-7 PROSPERO
low complexity region 4951 4964 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in cilia motility. Mutations in this gene cause of autosomal recessive primary ciliary dyskinesia-5, a disorder characterized by the accumulation of cerebrospinal fluid within the ventricles of the brain. A duplicate copy of this gene has been found in humans on chromosome 1. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a mutation in this gene develop hydrocephaly after birth. Symptoms develop after 3-5 days. Affected animals usually die before 2 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(3) Transgenic(1) Spontaneous(2)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik C T 14: 15,712,825 (GRCm39) probably benign Het
4930595D18Rik T A 12: 111,128,254 (GRCm39) probably benign Het
Adam34l T C 8: 44,079,186 (GRCm39) N346S possibly damaging Het
Alpi C T 1: 87,028,516 (GRCm39) A125T probably benign Het
Alppl2 T A 1: 87,014,957 (GRCm39) H468L probably damaging Het
Arhgef12 A T 9: 42,901,294 (GRCm39) L836* probably null Het
Arv1 T C 8: 125,458,658 (GRCm39) Y261H probably damaging Het
Atf6 C T 1: 170,662,402 (GRCm39) S286N probably benign Het
Atl3 G A 19: 7,509,705 (GRCm39) G478R probably damaging Het
Avil C T 10: 126,843,711 (GRCm39) R184C probably damaging Het
Bcl6b A G 11: 70,119,323 (GRCm39) I131T probably damaging Het
Bltp1 T A 3: 37,102,732 (GRCm39) M1437K Het
Catsper3 T C 13: 55,946,752 (GRCm39) S150P probably damaging Het
Cd7 A G 11: 120,928,637 (GRCm39) S132P probably benign Het
Cfh T C 1: 140,016,533 (GRCm39) D1142G probably damaging Het
Clca4b T G 3: 144,621,272 (GRCm39) K601Q probably benign Het
Cp A G 3: 20,033,126 (GRCm39) H651R probably damaging Het
Cyp2s1 T A 7: 25,507,529 (GRCm39) T307S probably damaging Het
Dcaf11 A G 14: 55,803,170 (GRCm39) D328G probably damaging Het
Eapp A T 12: 54,739,741 (GRCm39) S25R probably damaging Het
Ebag9 T A 15: 44,491,033 (GRCm39) probably null Het
Exog G A 9: 119,291,586 (GRCm39) E288K possibly damaging Het
Fads2 A T 19: 10,047,940 (GRCm39) Y265N probably damaging Het
Fam234b T A 6: 135,194,008 (GRCm39) S220R possibly damaging Het
Fcgbp T A 7: 27,803,012 (GRCm39) C1539S probably damaging Het
Fcsk T C 8: 111,615,563 (GRCm39) T589A probably benign Het
Fv1 C T 4: 147,954,621 (GRCm39) R396W probably damaging Het
Fv1 T C 4: 147,954,654 (GRCm39) F407L probably benign Het
Glp2r T C 11: 67,648,367 (GRCm39) T112A probably benign Het
Ighm T A 12: 113,386,097 (GRCm39) E84D probably benign Het
Ikzf5 A G 7: 130,994,012 (GRCm39) V205A probably benign Het
Kcnt1 G T 2: 25,797,351 (GRCm39) V844L probably benign Het
Kif2a A C 13: 107,106,304 (GRCm39) S528R probably damaging Het
Klhl29 G A 12: 5,190,641 (GRCm39) T118M probably damaging Het
Krt4 C A 15: 101,827,564 (GRCm39) G492C unknown Het
Lama1 T A 17: 68,116,940 (GRCm39) I2441N Het
Lin7a T C 10: 107,247,905 (GRCm39) V192A possibly damaging Het
Marchf8 T A 6: 116,378,990 (GRCm39) V308D probably damaging Het
Mgat5b T C 11: 116,838,074 (GRCm39) S238P possibly damaging Het
Mrps25 A G 6: 92,155,715 (GRCm39) S73P probably damaging Het
Muc6 G T 7: 141,216,310 (GRCm39) P2788T unknown Het
Ncf1 T C 5: 134,250,899 (GRCm39) T347A probably benign Het
Ndufaf4 T C 4: 24,903,177 (GRCm39) M122T probably benign Het
Nfil3 C T 13: 53,121,591 (GRCm39) A438T probably damaging Het
Noc2l T G 4: 156,328,022 (GRCm39) I504S probably damaging Het
Nphs1 T C 7: 30,166,955 (GRCm39) C735R probably damaging Het
Or10g6 A T 9: 39,934,171 (GRCm39) S161C probably benign Het
Or2y10 T C 11: 49,454,961 (GRCm39) L71P probably damaging Het
Or5d38 C A 2: 87,955,000 (GRCm39) V110L probably damaging Het
Or6b9 A C 7: 106,555,846 (GRCm39) L99R possibly damaging Het
Pcdhac1 A G 18: 37,225,506 (GRCm39) H773R probably benign Het
Pcnt A G 10: 76,237,314 (GRCm39) V1324A probably benign Het
Pcsk4 T C 10: 80,158,034 (GRCm39) Y568C probably damaging Het
Pdlim1 A T 19: 40,219,040 (GRCm39) M197K probably damaging Het
Plekho1 C T 3: 95,903,091 (GRCm39) G7S probably benign Het
Pramel17 A G 4: 101,692,965 (GRCm39) V345A possibly damaging Het
Prl7d1 A C 13: 27,898,339 (GRCm39) S57A probably benign Het
Prpf3 A G 3: 95,741,512 (GRCm39) V548A possibly damaging Het
Prss56 C T 1: 87,111,219 (GRCm39) P2L possibly damaging Het
Ric1 A G 19: 29,580,030 (GRCm39) D1277G possibly damaging Het
Rnf19b T A 4: 128,977,812 (GRCm39) D676E probably damaging Het
Rph3a T A 5: 121,100,521 (GRCm39) T126S probably benign Het
Sh3gl3 T C 7: 81,917,562 (GRCm39) probably null Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc35f2 T C 9: 53,708,385 (GRCm39) V126A probably benign Het
Snrnp200 A T 2: 127,068,240 (GRCm39) Q860L probably damaging Het
Srbd1 T C 17: 86,422,711 (GRCm39) N435S probably damaging Het
Tab2 A G 10: 7,795,214 (GRCm39) S349P possibly damaging Het
Tie1 A T 4: 118,330,183 (GRCm39) W1040R probably null Het
Tnni3k A T 3: 154,562,244 (GRCm39) Y678N probably damaging Het
Trav12-3 T C 14: 53,859,474 (GRCm39) V40A possibly damaging Het
Ttn G A 2: 76,576,379 (GRCm39) S24838L probably damaging Het
Ttn A G 2: 76,725,660 (GRCm39) W6158R unknown Het
Vegfa T C 17: 46,335,401 (GRCm39) S298G probably damaging Het
Zer1 T C 2: 29,997,643 (GRCm39) K421R probably benign Het
Zfp959 C A 17: 56,204,866 (GRCm39) T301N probably benign Het
Other mutations in Hydin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Hydin APN 8 111,296,434 (GRCm39) missense possibly damaging 0.69
IGL00432:Hydin APN 8 111,327,884 (GRCm39) missense probably damaging 0.98
IGL01025:Hydin APN 8 111,053,033 (GRCm39) missense probably benign 0.38
IGL01140:Hydin APN 8 111,124,694 (GRCm39) missense probably benign 0.14
IGL01317:Hydin APN 8 111,053,078 (GRCm39) missense probably damaging 0.98
IGL01473:Hydin APN 8 111,038,792 (GRCm39) missense probably benign 0.08
IGL01473:Hydin APN 8 111,081,585 (GRCm39) missense probably damaging 1.00
IGL01610:Hydin APN 8 111,284,345 (GRCm39) missense probably benign 0.00
IGL01685:Hydin APN 8 111,081,665 (GRCm39) nonsense probably null
IGL01734:Hydin APN 8 111,217,421 (GRCm39) nonsense probably null
IGL01743:Hydin APN 8 111,319,408 (GRCm39) missense possibly damaging 0.94
IGL01829:Hydin APN 8 111,316,154 (GRCm39) missense possibly damaging 0.68
IGL01919:Hydin APN 8 111,245,806 (GRCm39) missense possibly damaging 0.89
IGL01946:Hydin APN 8 111,217,350 (GRCm39) missense possibly damaging 0.91
IGL01983:Hydin APN 8 111,241,527 (GRCm39) missense probably benign 0.02
IGL02122:Hydin APN 8 111,221,047 (GRCm39) missense possibly damaging 0.86
IGL02140:Hydin APN 8 111,293,570 (GRCm39) missense probably benign
IGL02158:Hydin APN 8 111,336,598 (GRCm39) missense possibly damaging 0.89
IGL02167:Hydin APN 8 111,145,055 (GRCm39) missense possibly damaging 0.96
IGL02171:Hydin APN 8 111,178,590 (GRCm39) nonsense probably null
IGL02185:Hydin APN 8 111,233,108 (GRCm39) missense possibly damaging 0.86
IGL02517:Hydin APN 8 111,293,604 (GRCm39) missense probably benign 0.01
IGL02639:Hydin APN 8 111,265,081 (GRCm39) missense probably benign 0.01
IGL02644:Hydin APN 8 111,265,100 (GRCm39) missense probably damaging 1.00
IGL02652:Hydin APN 8 111,316,154 (GRCm39) missense possibly damaging 0.68
IGL02658:Hydin APN 8 111,139,908 (GRCm39) missense possibly damaging 0.86
IGL02706:Hydin APN 8 111,137,198 (GRCm39) missense probably damaging 0.99
IGL02892:Hydin APN 8 111,325,591 (GRCm39) missense possibly damaging 0.89
IGL02947:Hydin APN 8 111,145,094 (GRCm39) missense probably damaging 0.96
IGL03136:Hydin APN 8 111,145,156 (GRCm39) missense probably benign 0.22
IGL03248:Hydin APN 8 111,321,921 (GRCm39) missense probably damaging 0.97
IGL03251:Hydin APN 8 111,217,228 (GRCm39) missense probably damaging 1.00
IGL03350:Hydin APN 8 111,038,856 (GRCm39) missense possibly damaging 0.86
IGL03366:Hydin APN 8 110,993,995 (GRCm39) missense unknown
IGL03404:Hydin APN 8 111,296,409 (GRCm39) missense probably benign 0.06
Franz_joseph UTSW 8 111,327,950 (GRCm39) missense probably damaging 1.00
jahreszeiten UTSW 8 111,295,991 (GRCm39) missense probably damaging 1.00
maria UTSW 8 111,235,759 (GRCm39) splice site probably benign
schoepfung UTSW 8 111,326,877 (GRCm39) missense possibly damaging 0.68
surprise UTSW 8 111,254,648 (GRCm39) missense probably benign
teresa UTSW 8 111,336,303 (GRCm39) missense possibly damaging 0.79
BB001:Hydin UTSW 8 111,145,103 (GRCm39) missense possibly damaging 0.93
BB004:Hydin UTSW 8 111,307,476 (GRCm39) missense possibly damaging 0.89
BB011:Hydin UTSW 8 111,145,103 (GRCm39) missense possibly damaging 0.93
BB014:Hydin UTSW 8 111,307,476 (GRCm39) missense possibly damaging 0.89
P0005:Hydin UTSW 8 111,220,921 (GRCm39) critical splice acceptor site probably null
R0099:Hydin UTSW 8 111,316,193 (GRCm39) missense probably damaging 1.00
R0125:Hydin UTSW 8 111,189,163 (GRCm39) missense probably benign 0.12
R0157:Hydin UTSW 8 111,026,642 (GRCm39) missense possibly damaging 0.86
R0241:Hydin UTSW 8 111,124,655 (GRCm39) missense probably benign 0.04
R0241:Hydin UTSW 8 111,124,655 (GRCm39) missense probably benign 0.04
R0255:Hydin UTSW 8 111,291,650 (GRCm39) missense probably benign 0.00
R0352:Hydin UTSW 8 111,296,533 (GRCm39) critical splice donor site probably null
R0379:Hydin UTSW 8 111,235,759 (GRCm39) splice site probably benign
R0468:Hydin UTSW 8 111,139,855 (GRCm39) missense possibly damaging 0.96
R0477:Hydin UTSW 8 111,145,130 (GRCm39) missense probably damaging 1.00
R0479:Hydin UTSW 8 111,325,720 (GRCm39) missense probably damaging 1.00
R0539:Hydin UTSW 8 111,249,704 (GRCm39) missense probably benign
R0550:Hydin UTSW 8 111,314,407 (GRCm39) missense probably benign 0.01
R0571:Hydin UTSW 8 111,240,735 (GRCm39) splice site probably null
R0606:Hydin UTSW 8 111,276,430 (GRCm39) splice site probably benign
R0789:Hydin UTSW 8 111,293,603 (GRCm39) missense possibly damaging 0.53
R0849:Hydin UTSW 8 111,325,616 (GRCm39) missense probably damaging 1.00
R0946:Hydin UTSW 8 111,257,685 (GRCm39) missense probably benign 0.25
R1201:Hydin UTSW 8 111,296,487 (GRCm39) missense probably benign 0.01
R1375:Hydin UTSW 8 111,232,854 (GRCm39) critical splice donor site probably null
R1385:Hydin UTSW 8 111,249,836 (GRCm39) missense probably benign 0.40
R1411:Hydin UTSW 8 111,301,663 (GRCm39) missense probably benign 0.04
R1437:Hydin UTSW 8 111,308,617 (GRCm39) nonsense probably null
R1447:Hydin UTSW 8 111,249,798 (GRCm39) missense probably damaging 1.00
R1448:Hydin UTSW 8 111,173,217 (GRCm39) missense probably benign 0.27
R1466:Hydin UTSW 8 111,259,585 (GRCm39) missense possibly damaging 0.47
R1466:Hydin UTSW 8 111,259,585 (GRCm39) missense possibly damaging 0.47
R1523:Hydin UTSW 8 111,259,903 (GRCm39) missense probably benign 0.05
R1544:Hydin UTSW 8 111,301,486 (GRCm39) missense probably benign 0.30
R1581:Hydin UTSW 8 111,137,092 (GRCm39) missense probably benign
R1584:Hydin UTSW 8 111,307,447 (GRCm39) missense probably benign 0.27
R1598:Hydin UTSW 8 111,137,306 (GRCm39) missense possibly damaging 0.96
R1633:Hydin UTSW 8 111,233,614 (GRCm39) missense probably benign 0.10
R1777:Hydin UTSW 8 111,316,203 (GRCm39) missense probably benign 0.14
R1817:Hydin UTSW 8 111,259,459 (GRCm39) missense probably benign 0.00
R1828:Hydin UTSW 8 111,237,526 (GRCm39) missense probably benign 0.03
R1837:Hydin UTSW 8 111,296,257 (GRCm39) missense probably benign 0.20
R1848:Hydin UTSW 8 111,296,440 (GRCm39) missense probably benign 0.19
R1869:Hydin UTSW 8 111,227,337 (GRCm39) missense possibly damaging 0.94
R1909:Hydin UTSW 8 111,314,404 (GRCm39) missense probably damaging 1.00
R1928:Hydin UTSW 8 111,229,579 (GRCm39) missense possibly damaging 0.93
R1950:Hydin UTSW 8 111,336,619 (GRCm39) missense possibly damaging 0.64
R2095:Hydin UTSW 8 111,189,289 (GRCm39) missense probably damaging 0.96
R2172:Hydin UTSW 8 111,308,681 (GRCm39) missense probably benign 0.42
R2217:Hydin UTSW 8 111,145,138 (GRCm39) missense probably benign
R2248:Hydin UTSW 8 111,304,835 (GRCm39) missense probably benign 0.09
R2272:Hydin UTSW 8 111,035,764 (GRCm39) missense probably benign 0.01
R2294:Hydin UTSW 8 111,026,591 (GRCm39) missense probably damaging 0.99
R2315:Hydin UTSW 8 111,124,676 (GRCm39) missense probably benign 0.01
R2330:Hydin UTSW 8 111,291,641 (GRCm39) missense probably benign 0.01
R2374:Hydin UTSW 8 111,291,780 (GRCm39) missense probably damaging 1.00
R2446:Hydin UTSW 8 111,314,347 (GRCm39) missense possibly damaging 0.82
R2484:Hydin UTSW 8 111,239,747 (GRCm39) missense possibly damaging 0.76
R2698:Hydin UTSW 8 111,336,561 (GRCm39) missense possibly damaging 0.70
R2843:Hydin UTSW 8 111,245,746 (GRCm39) missense probably benign
R2844:Hydin UTSW 8 111,245,746 (GRCm39) missense probably benign
R2846:Hydin UTSW 8 111,245,746 (GRCm39) missense probably benign
R2882:Hydin UTSW 8 111,293,555 (GRCm39) missense possibly damaging 0.92
R2937:Hydin UTSW 8 111,130,927 (GRCm39) missense possibly damaging 0.88
R3031:Hydin UTSW 8 111,329,848 (GRCm39) missense possibly damaging 0.83
R3038:Hydin UTSW 8 111,309,321 (GRCm39) missense probably damaging 1.00
R3121:Hydin UTSW 8 111,233,138 (GRCm39) missense probably benign
R3157:Hydin UTSW 8 110,994,005 (GRCm39) missense unknown
R3547:Hydin UTSW 8 111,308,699 (GRCm39) missense possibly damaging 0.85
R3696:Hydin UTSW 8 111,329,911 (GRCm39) missense probably damaging 1.00
R3850:Hydin UTSW 8 111,290,561 (GRCm39) missense probably damaging 0.99
R3896:Hydin UTSW 8 111,235,711 (GRCm39) missense possibly damaging 0.93
R3983:Hydin UTSW 8 111,118,957 (GRCm39) missense probably damaging 1.00
R4031:Hydin UTSW 8 111,336,679 (GRCm39) missense probably benign 0.30
R4072:Hydin UTSW 8 111,231,888 (GRCm39) missense possibly damaging 0.68
R4095:Hydin UTSW 8 111,268,179 (GRCm39) missense probably damaging 0.98
R4176:Hydin UTSW 8 111,320,452 (GRCm39) missense probably benign 0.00
R4213:Hydin UTSW 8 111,183,139 (GRCm39) missense possibly damaging 0.91
R4412:Hydin UTSW 8 111,142,368 (GRCm39) missense probably damaging 0.99
R4471:Hydin UTSW 8 111,313,764 (GRCm39) missense probably damaging 1.00
R4474:Hydin UTSW 8 111,290,497 (GRCm39) missense probably benign 0.11
R4495:Hydin UTSW 8 111,322,034 (GRCm39) missense probably damaging 0.99
R4508:Hydin UTSW 8 111,245,886 (GRCm39) missense possibly damaging 0.91
R4578:Hydin UTSW 8 110,993,971 (GRCm39) missense unknown
R4583:Hydin UTSW 8 111,321,857 (GRCm39) missense probably benign 0.36
R4600:Hydin UTSW 8 111,293,582 (GRCm39) missense probably benign 0.04
R4681:Hydin UTSW 8 111,233,103 (GRCm39) missense possibly damaging 0.85
R4685:Hydin UTSW 8 111,189,154 (GRCm39) missense probably damaging 0.99
R4689:Hydin UTSW 8 111,322,046 (GRCm39) missense probably benign 0.18
R4735:Hydin UTSW 8 111,282,264 (GRCm39) critical splice donor site probably null
R4736:Hydin UTSW 8 111,249,840 (GRCm39) missense probably benign 0.02
R4740:Hydin UTSW 8 111,173,071 (GRCm39) missense probably benign 0.06
R4771:Hydin UTSW 8 111,259,515 (GRCm39) missense probably benign
R4777:Hydin UTSW 8 111,137,096 (GRCm39) missense probably damaging 0.98
R4859:Hydin UTSW 8 111,233,126 (GRCm39) missense possibly damaging 0.93
R4911:Hydin UTSW 8 111,322,070 (GRCm39) missense probably benign 0.01
R4964:Hydin UTSW 8 111,217,305 (GRCm39) missense possibly damaging 0.86
R4965:Hydin UTSW 8 111,124,727 (GRCm39) missense probably benign
R4989:Hydin UTSW 8 111,290,554 (GRCm39) missense possibly damaging 0.84
R4995:Hydin UTSW 8 111,296,274 (GRCm39) missense probably damaging 0.97
R5059:Hydin UTSW 8 111,232,401 (GRCm39) missense probably damaging 0.96
R5071:Hydin UTSW 8 111,265,105 (GRCm39) missense probably benign 0.03
R5073:Hydin UTSW 8 111,265,105 (GRCm39) missense probably benign 0.03
R5092:Hydin UTSW 8 111,309,300 (GRCm39) missense probably benign 0.16
R5156:Hydin UTSW 8 111,336,333 (GRCm39) missense probably benign 0.00
R5166:Hydin UTSW 8 111,249,774 (GRCm39) missense possibly damaging 0.89
R5189:Hydin UTSW 8 111,139,843 (GRCm39) critical splice acceptor site probably null
R5243:Hydin UTSW 8 111,232,380 (GRCm39) missense possibly damaging 0.92
R5244:Hydin UTSW 8 111,259,451 (GRCm39) missense possibly damaging 0.77
R5256:Hydin UTSW 8 111,313,855 (GRCm39) missense possibly damaging 0.92
R5266:Hydin UTSW 8 111,061,416 (GRCm39) missense possibly damaging 0.87
R5283:Hydin UTSW 8 111,178,612 (GRCm39) missense possibly damaging 0.96
R5343:Hydin UTSW 8 111,212,051 (GRCm39) missense probably benign 0.40
R5359:Hydin UTSW 8 111,265,004 (GRCm39) missense probably benign 0.00
R5390:Hydin UTSW 8 111,322,099 (GRCm39) missense probably benign
R5394:Hydin UTSW 8 111,266,474 (GRCm39) splice site probably null
R5441:Hydin UTSW 8 111,291,741 (GRCm39) missense possibly damaging 0.72
R5461:Hydin UTSW 8 111,245,863 (GRCm39) missense probably damaging 0.96
R5662:Hydin UTSW 8 111,307,341 (GRCm39) missense probably benign 0.02
R5695:Hydin UTSW 8 111,261,915 (GRCm39) missense probably benign 0.35
R5732:Hydin UTSW 8 111,178,690 (GRCm39) missense probably benign 0.03
R5774:Hydin UTSW 8 111,298,547 (GRCm39) nonsense probably null
R5780:Hydin UTSW 8 111,312,712 (GRCm39) missense probably damaging 1.00
R5787:Hydin UTSW 8 111,052,985 (GRCm39) missense probably damaging 0.99
R5802:Hydin UTSW 8 111,178,692 (GRCm39) missense possibly damaging 0.86
R5841:Hydin UTSW 8 111,259,846 (GRCm39) missense possibly damaging 0.76
R5856:Hydin UTSW 8 111,268,474 (GRCm39) missense probably damaging 0.99
R5893:Hydin UTSW 8 111,217,308 (GRCm39) missense probably benign 0.12
R5963:Hydin UTSW 8 111,220,926 (GRCm39) missense possibly damaging 0.93
R6008:Hydin UTSW 8 111,325,717 (GRCm39) missense probably benign 0.02
R6019:Hydin UTSW 8 111,293,252 (GRCm39) missense probably benign
R6038:Hydin UTSW 8 111,325,663 (GRCm39) missense probably benign 0.16
R6038:Hydin UTSW 8 111,325,663 (GRCm39) missense probably benign 0.16
R6133:Hydin UTSW 8 111,327,908 (GRCm39) missense probably benign 0.00
R6135:Hydin UTSW 8 111,189,292 (GRCm39) missense possibly damaging 0.85
R6157:Hydin UTSW 8 111,254,648 (GRCm39) missense probably benign
R6209:Hydin UTSW 8 111,320,434 (GRCm39) missense probably benign 0.05
R6238:Hydin UTSW 8 111,118,743 (GRCm39) splice site probably null
R6293:Hydin UTSW 8 111,324,543 (GRCm39) missense possibly damaging 0.83
R6340:Hydin UTSW 8 111,081,574 (GRCm39) splice site probably null
R6349:Hydin UTSW 8 111,145,091 (GRCm39) nonsense probably null
R6357:Hydin UTSW 8 111,268,289 (GRCm39) missense possibly damaging 0.86
R6385:Hydin UTSW 8 111,038,856 (GRCm39) missense possibly damaging 0.86
R6396:Hydin UTSW 8 111,233,521 (GRCm39) missense probably damaging 0.96
R6466:Hydin UTSW 8 111,233,600 (GRCm39) missense possibly damaging 0.85
R6648:Hydin UTSW 8 111,252,299 (GRCm39) splice site probably null
R6671:Hydin UTSW 8 111,327,950 (GRCm39) missense probably damaging 1.00
R6695:Hydin UTSW 8 111,053,092 (GRCm39) missense probably benign 0.05
R6800:Hydin UTSW 8 111,324,603 (GRCm39) missense probably benign 0.09
R6841:Hydin UTSW 8 111,265,007 (GRCm39) missense probably benign 0.09
R6867:Hydin UTSW 8 111,266,434 (GRCm39) missense probably benign 0.08
R6889:Hydin UTSW 8 111,259,488 (GRCm39) missense possibly damaging 0.79
R6895:Hydin UTSW 8 111,038,883 (GRCm39) missense probably benign 0.00
R6940:Hydin UTSW 8 111,217,243 (GRCm39) missense probably damaging 1.00
R6951:Hydin UTSW 8 111,124,757 (GRCm39) missense probably benign
R6980:Hydin UTSW 8 111,139,916 (GRCm39) missense possibly damaging 0.91
R6981:Hydin UTSW 8 111,257,704 (GRCm39) missense possibly damaging 0.89
R7061:Hydin UTSW 8 111,329,920 (GRCm39) missense possibly damaging 0.90
R7085:Hydin UTSW 8 111,329,962 (GRCm39) missense probably benign 0.03
R7086:Hydin UTSW 8 111,326,877 (GRCm39) missense possibly damaging 0.68
R7110:Hydin UTSW 8 111,081,583 (GRCm39) critical splice acceptor site probably null
R7158:Hydin UTSW 8 111,336,303 (GRCm39) missense possibly damaging 0.79
R7163:Hydin UTSW 8 111,329,968 (GRCm39) missense probably benign 0.25
R7209:Hydin UTSW 8 111,216,424 (GRCm39) nonsense probably null
R7244:Hydin UTSW 8 111,276,307 (GRCm39) missense probably damaging 0.98
R7347:Hydin UTSW 8 111,326,994 (GRCm39) missense probably benign 0.06
R7349:Hydin UTSW 8 111,124,803 (GRCm39) splice site probably null
R7359:Hydin UTSW 8 111,232,733 (GRCm39) missense probably damaging 0.98
R7365:Hydin UTSW 8 111,327,905 (GRCm39) missense probably damaging 1.00
R7365:Hydin UTSW 8 111,284,294 (GRCm39) missense probably damaging 0.99
R7436:Hydin UTSW 8 111,310,546 (GRCm39) missense probably damaging 0.96
R7528:Hydin UTSW 8 111,107,204 (GRCm39) nonsense probably null
R7544:Hydin UTSW 8 111,316,157 (GRCm39) missense probably benign 0.35
R7625:Hydin UTSW 8 111,268,476 (GRCm39) missense probably benign 0.01
R7713:Hydin UTSW 8 111,320,444 (GRCm39) missense possibly damaging 0.69
R7763:Hydin UTSW 8 111,232,475 (GRCm39) missense possibly damaging 0.92
R7771:Hydin UTSW 8 111,291,717 (GRCm39) missense probably damaging 0.97
R7794:Hydin UTSW 8 111,235,715 (GRCm39) missense probably damaging 1.00
R7833:Hydin UTSW 8 111,316,092 (GRCm39) missense probably damaging 0.99
R7894:Hydin UTSW 8 111,239,642 (GRCm39) missense possibly damaging 0.88
R7899:Hydin UTSW 8 111,314,380 (GRCm39) missense probably benign 0.00
R7908:Hydin UTSW 8 111,237,499 (GRCm39) missense probably benign 0.01
R7912:Hydin UTSW 8 111,282,239 (GRCm39) missense possibly damaging 0.68
R7919:Hydin UTSW 8 110,993,971 (GRCm39) missense unknown
R7924:Hydin UTSW 8 111,145,103 (GRCm39) missense possibly damaging 0.93
R7927:Hydin UTSW 8 111,307,476 (GRCm39) missense possibly damaging 0.89
R7970:Hydin UTSW 8 111,035,723 (GRCm39) missense probably damaging 0.99
R7993:Hydin UTSW 8 111,306,264 (GRCm39) missense probably benign
R8011:Hydin UTSW 8 111,310,541 (GRCm39) missense probably damaging 1.00
R8041:Hydin UTSW 8 111,301,626 (GRCm39) missense probably benign 0.02
R8080:Hydin UTSW 8 111,261,863 (GRCm39) missense probably benign 0.32
R8081:Hydin UTSW 8 111,092,101 (GRCm39) missense possibly damaging 0.93
R8095:Hydin UTSW 8 111,295,991 (GRCm39) missense probably damaging 1.00
R8157:Hydin UTSW 8 111,178,668 (GRCm39) missense probably benign 0.33
R8186:Hydin UTSW 8 111,336,277 (GRCm39) missense probably benign 0.14
R8205:Hydin UTSW 8 111,319,270 (GRCm39) missense possibly damaging 0.57
R8263:Hydin UTSW 8 111,178,705 (GRCm39) missense probably benign 0.00
R8288:Hydin UTSW 8 111,233,661 (GRCm39) missense probably damaging 0.96
R8298:Hydin UTSW 8 111,327,015 (GRCm39) missense probably damaging 1.00
R8309:Hydin UTSW 8 111,334,534 (GRCm39) missense probably benign 0.18
R8348:Hydin UTSW 8 111,329,878 (GRCm39) missense possibly damaging 0.68
R8356:Hydin UTSW 8 111,259,756 (GRCm39) missense possibly damaging 0.67
R8406:Hydin UTSW 8 111,336,543 (GRCm39) missense possibly damaging 0.94
R8415:Hydin UTSW 8 111,178,626 (GRCm39) missense probably damaging 1.00
R8417:Hydin UTSW 8 111,296,024 (GRCm39) missense probably benign 0.28
R8432:Hydin UTSW 8 111,324,583 (GRCm39) missense probably benign 0.02
R8437:Hydin UTSW 8 111,189,367 (GRCm39) missense probably damaging 0.96
R8463:Hydin UTSW 8 111,237,553 (GRCm39) missense probably benign 0.22
R8508:Hydin UTSW 8 111,308,650 (GRCm39) missense probably benign 0.00
R8510:Hydin UTSW 8 111,233,202 (GRCm39) missense probably damaging 1.00
R8560:Hydin UTSW 8 111,265,106 (GRCm39) missense probably benign 0.09
R8682:Hydin UTSW 8 111,035,798 (GRCm39) missense probably damaging 0.96
R8697:Hydin UTSW 8 111,259,515 (GRCm39) missense probably benign
R8857:Hydin UTSW 8 111,298,587 (GRCm39) critical splice donor site probably null
R8866:Hydin UTSW 8 111,308,779 (GRCm39) missense possibly damaging 0.89
R8878:Hydin UTSW 8 111,035,720 (GRCm39) missense probably benign 0.12
R8897:Hydin UTSW 8 111,316,112 (GRCm39) missense probably benign
R8987:Hydin UTSW 8 111,239,766 (GRCm39) nonsense probably null
R9072:Hydin UTSW 8 110,994,083 (GRCm39) critical splice donor site probably null
R9073:Hydin UTSW 8 110,994,083 (GRCm39) critical splice donor site probably null
R9102:Hydin UTSW 8 111,235,546 (GRCm39) missense probably benign 0.33
R9224:Hydin UTSW 8 111,259,516 (GRCm39) missense probably benign
R9255:Hydin UTSW 8 111,261,972 (GRCm39) missense probably benign 0.23
R9257:Hydin UTSW 8 111,301,648 (GRCm39) missense probably damaging 0.99
R9261:Hydin UTSW 8 110,994,047 (GRCm39) missense unknown
R9273:Hydin UTSW 8 111,233,580 (GRCm39) missense probably damaging 0.98
R9376:Hydin UTSW 8 111,124,695 (GRCm39) missense possibly damaging 0.70
R9380:Hydin UTSW 8 111,290,504 (GRCm39) missense probably benign 0.07
R9386:Hydin UTSW 8 111,314,362 (GRCm39) missense probably benign
R9406:Hydin UTSW 8 111,314,412 (GRCm39) missense probably null 0.96
R9492:Hydin UTSW 8 111,326,877 (GRCm39) missense possibly damaging 0.68
R9513:Hydin UTSW 8 111,322,114 (GRCm39) missense probably damaging 0.99
R9562:Hydin UTSW 8 111,312,786 (GRCm39) missense probably benign 0.11
R9664:Hydin UTSW 8 111,220,965 (GRCm39) missense probably benign 0.01
R9753:Hydin UTSW 8 111,217,398 (GRCm39) missense possibly damaging 0.85
X0063:Hydin UTSW 8 111,277,951 (GRCm39) missense probably damaging 1.00
Z1088:Hydin UTSW 8 111,319,423 (GRCm39) frame shift probably null
Z1088:Hydin UTSW 8 111,312,680 (GRCm39) missense probably benign 0.00
Z1088:Hydin UTSW 8 111,026,605 (GRCm39) missense probably benign 0.12
Z1176:Hydin UTSW 8 111,268,232 (GRCm39) missense possibly damaging 0.65
Z1177:Hydin UTSW 8 111,313,774 (GRCm39) frame shift probably null
Z1177:Hydin UTSW 8 111,176,864 (GRCm39) missense possibly damaging 0.47
Z1177:Hydin UTSW 8 111,107,242 (GRCm39) missense probably damaging 1.00
Z1177:Hydin UTSW 8 111,336,621 (GRCm39) missense probably benign 0.10
Z1188:Hydin UTSW 8 111,142,419 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGATCCTGGACATCCTAGGC -3'
(R):5'- GAGTAGCAATTATTTTCAGTCCCC -3'

Sequencing Primer
(F):5'- TGGACATCCTAGGCCTGGG -3'
(R):5'- GTCCCCTCCTAGGTAGACACAG -3'
Posted On 2022-11-14