Incidental Mutation 'R9733:Ighm'
ID 731573
Institutional Source Beutler Lab
Gene Symbol Ighm
Ensembl Gene ENSMUSG00000076617
Gene Name immunoglobulin heavy constant mu
Synonyms Igh-M, Ig mu, IgM, muH, Igh6
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R9733 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 113382446-113386350 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 113386097 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 84 (E84D)
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000103426
AA Change: E84D

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000100222
Gene: ENSMUSG00000076617
AA Change: E84D

DomainStartEndE-ValueType
IG_like 23 99 1.94e-2 SMART
IGc1 131 209 2.37e-14 SMART
IG_like 241 315 1.6e-2 SMART
IGc1 348 425 1.94e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177715
AA Change: E84D

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik C T 14: 15,712,825 (GRCm39) probably benign Het
4930595D18Rik T A 12: 111,128,254 (GRCm39) probably benign Het
Adam34l T C 8: 44,079,186 (GRCm39) N346S possibly damaging Het
Alpi C T 1: 87,028,516 (GRCm39) A125T probably benign Het
Alppl2 T A 1: 87,014,957 (GRCm39) H468L probably damaging Het
Arhgef12 A T 9: 42,901,294 (GRCm39) L836* probably null Het
Arv1 T C 8: 125,458,658 (GRCm39) Y261H probably damaging Het
Atf6 C T 1: 170,662,402 (GRCm39) S286N probably benign Het
Atl3 G A 19: 7,509,705 (GRCm39) G478R probably damaging Het
Avil C T 10: 126,843,711 (GRCm39) R184C probably damaging Het
Bcl6b A G 11: 70,119,323 (GRCm39) I131T probably damaging Het
Bltp1 T A 3: 37,102,732 (GRCm39) M1437K Het
Catsper3 T C 13: 55,946,752 (GRCm39) S150P probably damaging Het
Cd7 A G 11: 120,928,637 (GRCm39) S132P probably benign Het
Cfh T C 1: 140,016,533 (GRCm39) D1142G probably damaging Het
Clca4b T G 3: 144,621,272 (GRCm39) K601Q probably benign Het
Cp A G 3: 20,033,126 (GRCm39) H651R probably damaging Het
Cyp2s1 T A 7: 25,507,529 (GRCm39) T307S probably damaging Het
Dcaf11 A G 14: 55,803,170 (GRCm39) D328G probably damaging Het
Eapp A T 12: 54,739,741 (GRCm39) S25R probably damaging Het
Ebag9 T A 15: 44,491,033 (GRCm39) probably null Het
Exog G A 9: 119,291,586 (GRCm39) E288K possibly damaging Het
Fads2 A T 19: 10,047,940 (GRCm39) Y265N probably damaging Het
Fam234b T A 6: 135,194,008 (GRCm39) S220R possibly damaging Het
Fcgbp T A 7: 27,803,012 (GRCm39) C1539S probably damaging Het
Fcsk T C 8: 111,615,563 (GRCm39) T589A probably benign Het
Fv1 C T 4: 147,954,621 (GRCm39) R396W probably damaging Het
Fv1 T C 4: 147,954,654 (GRCm39) F407L probably benign Het
Glp2r T C 11: 67,648,367 (GRCm39) T112A probably benign Het
Hydin T C 8: 111,262,011 (GRCm39) I2704T probably benign Het
Ikzf5 A G 7: 130,994,012 (GRCm39) V205A probably benign Het
Kcnt1 G T 2: 25,797,351 (GRCm39) V844L probably benign Het
Kif2a A C 13: 107,106,304 (GRCm39) S528R probably damaging Het
Klhl29 G A 12: 5,190,641 (GRCm39) T118M probably damaging Het
Krt4 C A 15: 101,827,564 (GRCm39) G492C unknown Het
Lama1 T A 17: 68,116,940 (GRCm39) I2441N Het
Lin7a T C 10: 107,247,905 (GRCm39) V192A possibly damaging Het
Marchf8 T A 6: 116,378,990 (GRCm39) V308D probably damaging Het
Mgat5b T C 11: 116,838,074 (GRCm39) S238P possibly damaging Het
Mrps25 A G 6: 92,155,715 (GRCm39) S73P probably damaging Het
Muc6 G T 7: 141,216,310 (GRCm39) P2788T unknown Het
Ncf1 T C 5: 134,250,899 (GRCm39) T347A probably benign Het
Ndufaf4 T C 4: 24,903,177 (GRCm39) M122T probably benign Het
Nfil3 C T 13: 53,121,591 (GRCm39) A438T probably damaging Het
Noc2l T G 4: 156,328,022 (GRCm39) I504S probably damaging Het
Nphs1 T C 7: 30,166,955 (GRCm39) C735R probably damaging Het
Or10g6 A T 9: 39,934,171 (GRCm39) S161C probably benign Het
Or2y10 T C 11: 49,454,961 (GRCm39) L71P probably damaging Het
Or5d38 C A 2: 87,955,000 (GRCm39) V110L probably damaging Het
Or6b9 A C 7: 106,555,846 (GRCm39) L99R possibly damaging Het
Pcdhac1 A G 18: 37,225,506 (GRCm39) H773R probably benign Het
Pcnt A G 10: 76,237,314 (GRCm39) V1324A probably benign Het
Pcsk4 T C 10: 80,158,034 (GRCm39) Y568C probably damaging Het
Pdlim1 A T 19: 40,219,040 (GRCm39) M197K probably damaging Het
Plekho1 C T 3: 95,903,091 (GRCm39) G7S probably benign Het
Pramel17 A G 4: 101,692,965 (GRCm39) V345A possibly damaging Het
Prl7d1 A C 13: 27,898,339 (GRCm39) S57A probably benign Het
Prpf3 A G 3: 95,741,512 (GRCm39) V548A possibly damaging Het
Prss56 C T 1: 87,111,219 (GRCm39) P2L possibly damaging Het
Ric1 A G 19: 29,580,030 (GRCm39) D1277G possibly damaging Het
Rnf19b T A 4: 128,977,812 (GRCm39) D676E probably damaging Het
Rph3a T A 5: 121,100,521 (GRCm39) T126S probably benign Het
Sh3gl3 T C 7: 81,917,562 (GRCm39) probably null Het
Slc14a1 C A 18: 78,152,807 (GRCm39) A367S probably damaging Het
Slc35f2 T C 9: 53,708,385 (GRCm39) V126A probably benign Het
Snrnp200 A T 2: 127,068,240 (GRCm39) Q860L probably damaging Het
Srbd1 T C 17: 86,422,711 (GRCm39) N435S probably damaging Het
Tab2 A G 10: 7,795,214 (GRCm39) S349P possibly damaging Het
Tie1 A T 4: 118,330,183 (GRCm39) W1040R probably null Het
Tnni3k A T 3: 154,562,244 (GRCm39) Y678N probably damaging Het
Trav12-3 T C 14: 53,859,474 (GRCm39) V40A possibly damaging Het
Ttn G A 2: 76,576,379 (GRCm39) S24838L probably damaging Het
Ttn A G 2: 76,725,660 (GRCm39) W6158R unknown Het
Vegfa T C 17: 46,335,401 (GRCm39) S298G probably damaging Het
Zer1 T C 2: 29,997,643 (GRCm39) K421R probably benign Het
Zfp959 C A 17: 56,204,866 (GRCm39) T301N probably benign Het
Other mutations in Ighm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Ighm APN 12 113,384,854 (GRCm39) unclassified probably benign
IGL01775:Ighm APN 12 113,386,087 (GRCm39) missense unknown
IGL02069:Ighm APN 12 113,384,768 (GRCm39) unclassified probably benign
IGL03124:Ighm APN 12 113,385,258 (GRCm39) missense unknown
Destiny UTSW 12 113,385,165 (GRCm39) missense
manifest UTSW 12 113,384,873 (GRCm39) nonsense probably null
G1Funyon:Ighm UTSW 12 113,385,165 (GRCm39) missense
R3055:Ighm UTSW 12 113,382,596 (GRCm39) unclassified probably benign
R3056:Ighm UTSW 12 113,382,596 (GRCm39) unclassified probably benign
R4164:Ighm UTSW 12 113,385,915 (GRCm39) missense unknown
R4475:Ighm UTSW 12 113,384,513 (GRCm39) unclassified probably benign
R4871:Ighm UTSW 12 113,385,241 (GRCm39) missense unknown
R5542:Ighm UTSW 12 113,382,601 (GRCm39) unclassified probably benign
R5738:Ighm UTSW 12 113,385,115 (GRCm39) missense unknown
R5856:Ighm UTSW 12 113,385,222 (GRCm39) missense unknown
R5946:Ighm UTSW 12 113,386,329 (GRCm39) missense unknown
R6267:Ighm UTSW 12 113,385,187 (GRCm39) missense unknown
R6296:Ighm UTSW 12 113,385,187 (GRCm39) missense unknown
R7409:Ighm UTSW 12 113,385,852 (GRCm39) missense
R7492:Ighm UTSW 12 113,386,293 (GRCm39) missense
R7898:Ighm UTSW 12 113,384,873 (GRCm39) nonsense probably null
R8089:Ighm UTSW 12 113,384,854 (GRCm39) unclassified probably benign
R8301:Ighm UTSW 12 113,385,165 (GRCm39) missense
R8444:Ighm UTSW 12 113,384,813 (GRCm39) missense
R9378:Ighm UTSW 12 113,386,210 (GRCm39) missense
R9447:Ighm UTSW 12 113,384,794 (GRCm39) missense
R9674:Ighm UTSW 12 113,385,139 (GRCm39) missense
R9803:Ighm UTSW 12 113,382,635 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TTGGGGTTCATCTCTGCGAC -3'
(R):5'- CCCTGTCTGATAAGAATCTGGTG -3'

Sequencing Primer
(F):5'- TCATCTCTGCGACAGCTGGAATG -3'
(R):5'- CTGATAAGAATCTGGTGGCCATG -3'
Posted On 2022-11-14