Mutagenetix > Incidental Mutation

Incidental Mutation 'R9734:Grid1'

731619

Institutional Source

Beutler Lab

Gene Symbol

Grid1

Ensembl Gene

ENSMUSG00000041078

Gene Name

glutamate receptor, ionotropic, delta 1

Synonyms

GluRdelta1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R9734 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34542065-35305336 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 35302742 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1002 (D1002E)

Ref Sequence

ENSEMBL: ENSMUSP00000044009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043349]

AlphaFold

Q61627

Predicted Effect

probably benign
Transcript: ENSMUST00000043349
AA Change: D1002E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000044009
Gene: ENSMUSG00000041078
AA Change: D1002E

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	36	400	4.1e-51	PFAM
PBPe	438	807	4.68e-110	SMART
Lig_chan-Glu_bd	448	510	8.18e-25	SMART
low complexity region	838	853	N/A	INTRINSIC
low complexity region	943	958	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of glutamate receptor channels. These channels mediate most of the fast excitatory synaptic transmission in the central nervous system and play key roles in synaptic plasticity.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation display a significant high-frequency hearing loss, associated with reductions of both cochlear outer hair cell function and endolymphatic potential, as well as increased vulnerability to acoustic injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot7	T	A	4: 152,345,474 (GRCm39)	V348E	probably damaging	Het
Adgrf5	T	C	17: 43,763,199 (GRCm39)	L1270P	probably damaging	Het
Akap12	C	T	10: 4,305,929 (GRCm39)	T1018M	probably damaging	Het
Bnip3l	G	A	14: 67,246,214 (GRCm39)	P7L	possibly damaging	Het
Bod1l	A	T	5: 41,962,573 (GRCm39)	D2721E	possibly damaging	Het
Bri3bp	G	T	5: 125,518,736 (GRCm39)	R4L	unknown	Het
Cnbd2	T	A	2: 156,180,540 (GRCm39)	N241K	possibly damaging	Het
Cpne2	A	G	8: 95,295,228 (GRCm39)	I438V	probably benign	Het
Crybg2	A	G	4: 133,801,962 (GRCm39)	T732A	probably benign	Het
D6Ertd527e	G	C	6: 87,088,839 (GRCm39)	S334T	unknown	Het
Dbt	T	C	3: 116,339,704 (GRCm39)	V364A	probably benign	Het
Fbn1	A	G	2: 125,231,898 (GRCm39)	V412A	probably benign	Het
Fsip1	T	A	2: 118,070,916 (GRCm39)	Q258L	probably benign	Het
Gabrg3	A	G	7: 56,634,908 (GRCm39)	Y92H	probably damaging	Het
Guf1	T	A	5: 69,726,605 (GRCm39)	C565*	probably null	Het
Iqce	G	T	5: 140,678,564 (GRCm39)	R127S	probably damaging	Het
Lama3	A	T	18: 12,682,320 (GRCm39)	E1095D	possibly damaging	Het
Lamb2	G	T	9: 108,365,830 (GRCm39)	G1445W	probably damaging	Het
Mmp25	C	T	17: 23,850,834 (GRCm39)	V367M	possibly damaging	Het
Mucl3	T	A	17: 35,949,233 (GRCm39)	D122V	probably benign	Het
Or10d4c	T	C	9: 39,558,202 (GRCm39)	F60S	probably damaging	Het
Or8b3b	A	T	9: 38,584,239 (GRCm39)	I167N	probably benign	Het
Pramel30	A	G	4: 144,057,737 (GRCm39)	M115V	probably benign	Het
Rusc1	A	T	3: 88,996,496 (GRCm39)	S696T	probably damaging	Het
Scamp2	T	G	9: 57,490,175 (GRCm39)	F225V	possibly damaging	Het
Stim1	A	G	7: 102,064,560 (GRCm39)	H210R	possibly damaging	Het
Vil1	T	C	1: 74,454,309 (GRCm39)	I24T	possibly damaging	Het
Vmn1r218	T	A	13: 23,321,034 (GRCm39)	L127H	probably damaging	Het
Vmn2r29	A	G	7: 7,234,492 (GRCm39)	V798A	probably damaging	Het
Vmn2r68	T	A	7: 84,882,757 (GRCm39)	T332S	possibly damaging	Het
Zfp366	A	G	13: 99,365,352 (GRCm39)	Y171C	probably damaging	Het

Other mutations in Grid1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00705:Grid1	APN	14	35,167,844 (GRCm39)	missense	possibly damaging	0.70
IGL01016:Grid1	APN	14	34,544,596 (GRCm39)	nonsense	probably null
IGL01643:Grid1	APN	14	35,045,392 (GRCm39)	critical splice donor site	probably null
IGL01697:Grid1	APN	14	35,031,214 (GRCm39)	missense	probably benign	0.21
IGL01879:Grid1	APN	14	35,172,327 (GRCm39)	missense	possibly damaging	0.93
IGL01975:Grid1	APN	14	35,045,383 (GRCm39)	missense	probably benign
IGL02515:Grid1	APN	14	35,174,302 (GRCm39)	missense	probably damaging	0.99
IGL02935:Grid1	APN	14	34,544,515 (GRCm39)	missense	possibly damaging	0.86
IGL03279:Grid1	APN	14	34,667,722 (GRCm39)	missense	probably damaging	0.98
IGL03286:Grid1	APN	14	35,242,642 (GRCm39)	splice site	probably benign
IGL03296:Grid1	APN	14	35,302,524 (GRCm39)	missense	possibly damaging	0.52
IGL03305:Grid1	APN	14	34,973,664 (GRCm39)	missense	probably damaging	1.00
R0533:Grid1	UTSW	14	35,031,342 (GRCm39)	missense	possibly damaging	0.84
R0746:Grid1	UTSW	14	34,544,647 (GRCm39)	missense	possibly damaging	0.92
R0811:Grid1	UTSW	14	34,544,576 (GRCm39)	missense	probably benign
R0812:Grid1	UTSW	14	34,544,576 (GRCm39)	missense	probably benign
R1144:Grid1	UTSW	14	35,284,633 (GRCm39)	splice site	probably benign
R1217:Grid1	UTSW	14	34,542,186 (GRCm39)	start codon destroyed	probably null	0.53
R1485:Grid1	UTSW	14	34,544,540 (GRCm39)	missense	probably damaging	1.00
R1529:Grid1	UTSW	14	35,031,250 (GRCm39)	missense	probably benign	0.36
R1606:Grid1	UTSW	14	35,167,922 (GRCm39)	missense	probably damaging	0.96
R1691:Grid1	UTSW	14	35,174,286 (GRCm39)	missense	probably damaging	1.00
R1759:Grid1	UTSW	14	35,167,988 (GRCm39)	missense	possibly damaging	0.92
R2374:Grid1	UTSW	14	35,043,764 (GRCm39)	splice site	probably benign
R2415:Grid1	UTSW	14	35,172,326 (GRCm39)	missense	possibly damaging	0.69
R2866:Grid1	UTSW	14	35,284,516 (GRCm39)	missense	probably damaging	1.00
R3915:Grid1	UTSW	14	35,242,684 (GRCm39)	missense	probably damaging	1.00
R4044:Grid1	UTSW	14	35,172,358 (GRCm39)	splice site	probably benign
R4364:Grid1	UTSW	14	34,667,989 (GRCm39)	missense	probably benign	0.20
R4691:Grid1	UTSW	14	35,291,514 (GRCm39)	missense	probably benign
R4694:Grid1	UTSW	14	34,748,737 (GRCm39)	missense	probably damaging	1.00
R4749:Grid1	UTSW	14	35,302,644 (GRCm39)	missense	possibly damaging	0.50
R4794:Grid1	UTSW	14	34,544,579 (GRCm39)	missense	probably damaging	0.99
R4854:Grid1	UTSW	14	35,043,598 (GRCm39)	missense	probably benign
R5555:Grid1	UTSW	14	35,242,662 (GRCm39)	missense	possibly damaging	0.92
R6005:Grid1	UTSW	14	35,045,369 (GRCm39)	missense	probably damaging	1.00
R6176:Grid1	UTSW	14	35,284,504 (GRCm39)	missense	probably benign	0.00
R6569:Grid1	UTSW	14	35,045,296 (GRCm39)	missense	possibly damaging	0.72
R6911:Grid1	UTSW	14	34,542,185 (GRCm39)	start codon destroyed	probably benign	0.08
R7504:Grid1	UTSW	14	35,284,470 (GRCm39)	missense	probably damaging	1.00
R7744:Grid1	UTSW	14	35,172,036 (GRCm39)	missense	probably damaging	1.00
R7795:Grid1	UTSW	14	35,043,642 (GRCm39)	missense	probably damaging	1.00
R7883:Grid1	UTSW	14	35,172,259 (GRCm39)	splice site	probably null
R7913:Grid1	UTSW	14	35,291,654 (GRCm39)	missense	probably damaging	0.99
R8032:Grid1	UTSW	14	35,045,316 (GRCm39)	missense	probably benign	0.00
R8333:Grid1	UTSW	14	35,291,595 (GRCm39)	missense	possibly damaging	0.82
R8916:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R8928:Grid1	UTSW	14	35,302,723 (GRCm39)	missense	probably benign	0.25
R8934:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R8935:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R8939:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R8986:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R8993:Grid1	UTSW	14	34,748,899 (GRCm39)	missense	probably benign	0.00
R9238:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R9310:Grid1	UTSW	14	34,748,762 (GRCm39)	missense	probably damaging	1.00
R9332:Grid1	UTSW	14	35,045,360 (GRCm39)	missense	probably benign	0.06
R9335:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R9336:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R9478:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R9479:Grid1	UTSW	14	35,043,664 (GRCm39)	missense	probably damaging	1.00
R9496:Grid1	UTSW	14	35,291,571 (GRCm39)	missense	probably damaging	1.00
R9583:Grid1	UTSW	14	35,302,492 (GRCm39)	missense	possibly damaging	0.90
R9601:Grid1	UTSW	14	35,167,814 (GRCm39)	missense	probably damaging	0.99
U24488:Grid1	UTSW	14	35,302,534 (GRCm39)	missense	probably benign	0.00
Z1088:Grid1	UTSW	14	35,174,251 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCGTCCATTGAGCTTTCTGC -3'
(R):5'- GCTCCTTTGGCACTTCAGAATG -3'

Sequencing Primer
(F):5'- CATTGAGCTTTCTGCCCTAGAGATG -3'
(R):5'- TGGCACTTCAGAATGATCACAAG -3'

Posted On

2022-11-14