Mutagenetix > Incidental Mutation

Incidental Mutation 'R9735:Mylk'

731649

Institutional Source

Beutler Lab

Gene Symbol

Mylk

Ensembl Gene

ENSMUSG00000022836

Gene Name

myosin, light polypeptide kinase

Synonyms

Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9735 (G1)

Quality Score

204.009

Status

Not validated

Chromosome

Chromosomal Location

34565580-34822790 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34735179 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 720 (F720L)

Ref Sequence

ENSEMBL: ENSMUSP00000023538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023538]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000023538
AA Change: F720L

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: F720L

Domain	Start	End	E-Value	Type
IGc2	54	122	9.05e-11	SMART
IGc2	177	244	3.94e-11	SMART
Pfam:23ISL	255	409	3.6e-60	PFAM
IGc2	423	491	1.55e-9	SMART
IGc2	523	587	3.32e-18	SMART
IGc2	632	699	6.02e-7	SMART
IGc2	730	798	1.36e-5	SMART
low complexity region	827	844	N/A	INTRINSIC
IGc2	1141	1208	2.42e-11	SMART
low complexity region	1251	1269	N/A	INTRINSIC
IG	1275	1359	4.56e-7	SMART
FN3	1362	1444	2.33e-11	SMART
low complexity region	1457	1479	N/A	INTRINSIC
S_TKc	1495	1750	4.23e-95	SMART
IGc2	1852	1920	5.92e-15	SMART
low complexity region	1934	1950	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 99.1%
20x: 98.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	T	C	8: 89,037,262 (GRCm39)	V215A	probably benign	Het
Arhgef12	G	A	9: 42,882,399 (GRCm39)	R1482*	probably null	Het
Atp9b	A	T	18: 80,838,629 (GRCm39)	D428E		Het
Bnip3l	G	A	14: 67,246,214 (GRCm39)	P7L	possibly damaging	Het
Cd6	A	G	19: 10,775,235 (GRCm39)	S296P	probably benign	Het
Cpt1a	A	G	19: 3,420,825 (GRCm39)	R428G	probably benign	Het
Csmd2	A	C	4: 128,402,901 (GRCm39)	T2330P		Het
D6Ertd527e	G	C	6: 87,088,839 (GRCm39)	S334T	unknown	Het
Dcaf4	T	A	12: 83,572,939 (GRCm39)	I18N	probably benign	Het
Ern1	A	T	11: 106,312,708 (GRCm39)	Y224*	probably null	Het
Ero1a	T	A	14: 45,533,435 (GRCm39)	S224C	possibly damaging	Het
Fcgbpl1	T	A	7: 27,856,435 (GRCm39)	V2074E	probably damaging	Het
Flg2	A	G	3: 93,127,669 (GRCm39)	S2194G	unknown	Het
Fnip1	A	T	11: 54,394,273 (GRCm39)	D903V	probably damaging	Het
Lss	G	T	10: 76,382,615 (GRCm39)	A497S	probably benign	Het
Mark3	T	C	12: 111,621,882 (GRCm39)	F675L	probably benign	Het
Nup210	A	C	6: 91,030,630 (GRCm39)	S884A	probably benign	Het
Or2j6	T	A	7: 139,980,378 (GRCm39)	M194L	probably benign	Het
Or4p20	A	T	2: 88,253,501 (GRCm39)	N289K	probably damaging	Het
Osbpl5	C	T	7: 143,248,673 (GRCm39)	V630I	possibly damaging	Het
Pkd1l2	A	G	8: 117,772,820 (GRCm39)	I1069T	possibly damaging	Het
Rnaseh2a	C	T	8: 85,686,661 (GRCm39)	V163M	probably damaging	Het
Septin9	T	A	11: 117,245,680 (GRCm39)	V434E	probably damaging	Het
Slc36a3	A	T	11: 55,026,104 (GRCm39)	I238N	probably damaging	Het
Spin1	T	A	13: 51,293,521 (GRCm39)	L77Q	probably damaging	Het
Spint1	A	G	2: 119,076,897 (GRCm39)	D327G	probably damaging	Het
Tmub2	A	G	11: 102,178,352 (GRCm39)	D123G		Het
Vps13a	A	T	19: 16,701,111 (GRCm39)	L686Q	probably damaging	Het
Zfp51	C	A	17: 21,685,413 (GRCm39)	S676*	probably null	Het

Other mutations in Mylk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01384:Mylk	APN	16	34,759,322 (GRCm39)	missense	probably benign	0.36
IGL01386:Mylk	APN	16	34,791,610 (GRCm39)	critical splice acceptor site	probably null
IGL01684:Mylk	APN	16	34,792,310 (GRCm39)	missense	possibly damaging	0.55
IGL01884:Mylk	APN	16	34,809,247 (GRCm39)	splice site	probably benign
IGL02079:Mylk	APN	16	34,681,001 (GRCm39)	missense	possibly damaging	0.87
IGL02104:Mylk	APN	16	34,635,805 (GRCm39)	missense	probably benign	0.06
IGL02624:Mylk	APN	16	34,750,266 (GRCm39)	missense	probably benign	0.29
IGL02756:Mylk	APN	16	34,784,016 (GRCm39)	missense	probably benign	0.42
IGL02794:Mylk	APN	16	34,806,911 (GRCm39)	missense	probably benign	0.21
IGL02833:Mylk	APN	16	34,735,270 (GRCm39)	missense	probably benign	0.01
IGL02946:Mylk	APN	16	34,742,158 (GRCm39)	missense	probably benign	0.10
IGL03012:Mylk	APN	16	34,773,151 (GRCm39)	missense	probably benign	0.03
IGL03093:Mylk	APN	16	34,732,562 (GRCm39)	missense	possibly damaging	0.62
IGL03272:Mylk	APN	16	34,799,559 (GRCm39)	missense	probably benign	0.09
billy	UTSW	16	34,695,990 (GRCm39)	missense	probably damaging	0.97
brutus	UTSW	16	34,774,065 (GRCm39)	missense	probably benign	0.12
Club	UTSW	16	34,732,645 (GRCm39)	nonsense	probably null
popeye	UTSW	16	34,783,947 (GRCm39)	missense	probably benign	0.29
F5770:Mylk	UTSW	16	34,815,574 (GRCm39)	critical splice donor site	probably null
P4717OSA:Mylk	UTSW	16	34,797,483 (GRCm39)	splice site	probably benign
PIT4382001:Mylk	UTSW	16	34,696,012 (GRCm39)	missense	probably damaging	0.99
R0131:Mylk	UTSW	16	34,695,874 (GRCm39)	missense	probably benign	0.03
R0309:Mylk	UTSW	16	34,732,667 (GRCm39)	splice site	probably benign
R0358:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0381:Mylk	UTSW	16	34,605,344 (GRCm39)	splice site	probably null
R0390:Mylk	UTSW	16	34,695,990 (GRCm39)	missense	probably damaging	0.97
R0413:Mylk	UTSW	16	34,742,314 (GRCm39)	missense	probably benign	0.01
R0536:Mylk	UTSW	16	34,820,757 (GRCm39)	missense	possibly damaging	0.95
R0544:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0545:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0546:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0547:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0548:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0627:Mylk	UTSW	16	34,820,799 (GRCm39)	missense	probably damaging	1.00
R0726:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0755:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0782:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0783:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0784:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R1136:Mylk	UTSW	16	34,820,688 (GRCm39)	missense	probably damaging	1.00
R1170:Mylk	UTSW	16	34,694,409 (GRCm39)	missense	probably benign	0.20
R1222:Mylk	UTSW	16	34,681,022 (GRCm39)	missense	probably benign	0.12
R1445:Mylk	UTSW	16	34,635,835 (GRCm39)	missense	possibly damaging	0.57
R1583:Mylk	UTSW	16	34,695,956 (GRCm39)	missense	probably benign	0.29
R1618:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R1643:Mylk	UTSW	16	34,696,005 (GRCm39)	missense	probably benign	0.03
R1702:Mylk	UTSW	16	34,742,314 (GRCm39)	missense	probably benign	0.00
R1776:Mylk	UTSW	16	34,773,152 (GRCm39)	missense	probably benign	0.16
R1865:Mylk	UTSW	16	34,732,600 (GRCm39)	missense	probably benign	0.03
R1975:Mylk	UTSW	16	34,700,673 (GRCm39)	splice site	probably null
R2016:Mylk	UTSW	16	34,817,187 (GRCm39)	missense	probably damaging	1.00
R2045:Mylk	UTSW	16	34,774,023 (GRCm39)	missense	probably benign	0.29
R2134:Mylk	UTSW	16	34,806,846 (GRCm39)	missense	probably benign	0.13
R3547:Mylk	UTSW	16	34,700,538 (GRCm39)	missense	possibly damaging	0.61
R3844:Mylk	UTSW	16	34,742,247 (GRCm39)	missense	probably benign	0.01
R4003:Mylk	UTSW	16	34,783,947 (GRCm39)	missense	probably benign	0.29
R4396:Mylk	UTSW	16	34,732,645 (GRCm39)	nonsense	probably null
R4470:Mylk	UTSW	16	34,732,522 (GRCm39)	missense	probably benign	0.09
R4507:Mylk	UTSW	16	34,774,065 (GRCm39)	missense	probably benign	0.12
R4700:Mylk	UTSW	16	34,742,805 (GRCm39)	missense	probably benign	0.16
R4751:Mylk	UTSW	16	34,699,539 (GRCm39)	missense	probably benign	0.29
R4815:Mylk	UTSW	16	34,715,295 (GRCm39)	missense	probably damaging	0.97
R4832:Mylk	UTSW	16	34,742,737 (GRCm39)	missense	probably benign	0.36
R4872:Mylk	UTSW	16	34,735,360 (GRCm39)	missense	possibly damaging	0.89
R4953:Mylk	UTSW	16	34,809,331 (GRCm39)	missense	probably damaging	1.00
R4969:Mylk	UTSW	16	34,791,810 (GRCm39)	missense	probably damaging	0.96
R5009:Mylk	UTSW	16	34,719,877 (GRCm39)	missense	probably benign	0.39
R5130:Mylk	UTSW	16	34,809,367 (GRCm39)	missense	probably damaging	1.00
R5173:Mylk	UTSW	16	34,797,383 (GRCm39)	missense	probably benign	0.40
R5195:Mylk	UTSW	16	34,799,585 (GRCm39)	missense	probably damaging	1.00
R5209:Mylk	UTSW	16	34,742,995 (GRCm39)	missense	possibly damaging	0.55
R5311:Mylk	UTSW	16	34,742,127 (GRCm39)	missense	probably benign	0.01
R5418:Mylk	UTSW	16	34,732,600 (GRCm39)	missense	probably benign	0.02
R5481:Mylk	UTSW	16	34,741,974 (GRCm39)	missense	probably benign	0.09
R5590:Mylk	UTSW	16	34,699,722 (GRCm39)	missense	probably benign	0.29
R5603:Mylk	UTSW	16	34,776,862 (GRCm39)	missense	probably benign	0.06
R5823:Mylk	UTSW	16	34,715,317 (GRCm39)	critical splice donor site	probably null
R6290:Mylk	UTSW	16	34,715,213 (GRCm39)	missense	probably benign	0.39
R6351:Mylk	UTSW	16	34,742,341 (GRCm39)	missense	probably benign	0.01
R6365:Mylk	UTSW	16	34,680,961 (GRCm39)	missense	probably benign	0.12
R6490:Mylk	UTSW	16	34,750,237 (GRCm39)	missense	possibly damaging	0.74
R6723:Mylk	UTSW	16	34,750,258 (GRCm39)	missense	possibly damaging	0.74
R6864:Mylk	UTSW	16	34,694,520 (GRCm39)	missense	probably benign	0.03
R6908:Mylk	UTSW	16	34,700,643 (GRCm39)	missense	probably benign	0.18
R6949:Mylk	UTSW	16	34,820,688 (GRCm39)	missense	probably damaging	1.00
R7018:Mylk	UTSW	16	34,820,796 (GRCm39)	missense	possibly damaging	0.88
R7035:Mylk	UTSW	16	34,797,352 (GRCm39)	missense	possibly damaging	0.89
R7162:Mylk	UTSW	16	34,742,899 (GRCm39)	missense	probably damaging	1.00
R7236:Mylk	UTSW	16	34,742,899 (GRCm39)	missense	probably damaging	1.00
R7269:Mylk	UTSW	16	34,605,381 (GRCm39)	missense	probably damaging	0.96
R7475:Mylk	UTSW	16	34,734,446 (GRCm39)	splice site	probably null
R7525:Mylk	UTSW	16	34,809,357 (GRCm39)	missense	probably benign	0.06
R7587:Mylk	UTSW	16	34,742,887 (GRCm39)	missense	probably benign	0.29
R7607:Mylk	UTSW	16	34,715,184 (GRCm39)	missense	probably benign	0.09
R7616:Mylk	UTSW	16	34,699,927 (GRCm39)	missense	probably damaging	0.97
R7647:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R7648:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R7764:Mylk	UTSW	16	34,742,553 (GRCm39)	missense	probably benign	0.16
R7890:Mylk	UTSW	16	34,784,018 (GRCm39)	nonsense	probably null
R7892:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R7893:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R8065:Mylk	UTSW	16	34,792,389 (GRCm39)	missense	probably benign	0.08
R8067:Mylk	UTSW	16	34,792,389 (GRCm39)	missense	probably benign	0.08
R8143:Mylk	UTSW	16	34,734,525 (GRCm39)	missense	possibly damaging	0.87
R8210:Mylk	UTSW	16	34,820,721 (GRCm39)	missense	probably damaging	1.00
R8271:Mylk	UTSW	16	34,742,949 (GRCm39)	missense	probably damaging	0.97
R8540:Mylk	UTSW	16	34,750,257 (GRCm39)	missense	possibly damaging	0.87
R8721:Mylk	UTSW	16	34,817,176 (GRCm39)	missense	probably damaging	1.00
R8743:Mylk	UTSW	16	34,741,427 (GRCm39)	missense	probably benign	0.03
R8798:Mylk	UTSW	16	34,719,772 (GRCm39)	missense	possibly damaging	0.89
R8956:Mylk	UTSW	16	34,791,779 (GRCm39)	missense	probably benign	0.01
R9131:Mylk	UTSW	16	34,776,835 (GRCm39)	missense	probably benign	0.29
R9403:Mylk	UTSW	16	34,696,012 (GRCm39)	nonsense	probably null
R9624:Mylk	UTSW	16	34,699,677 (GRCm39)	missense	probably benign	0.29
R9756:Mylk	UTSW	16	34,734,387 (GRCm39)	missense	probably damaging	0.96
R9763:Mylk	UTSW	16	34,699,482 (GRCm39)	nonsense	probably null
RF001:Mylk	UTSW	16	34,699,741 (GRCm39)	missense	probably benign	0.03
V7580:Mylk	UTSW	16	34,815,574 (GRCm39)	critical splice donor site	probably null
V7583:Mylk	UTSW	16	34,815,574 (GRCm39)	critical splice donor site	probably null
X0065:Mylk	UTSW	16	34,820,811 (GRCm39)	missense	probably damaging	1.00
Z1177:Mylk	UTSW	16	34,743,021 (GRCm39)	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- AAAAGATGTACCGTGTCCACATACC -3'
(R):5'- ATCTCATACTGGCCGGCATG -3'

Sequencing Primer
(F):5'- TACCCAGTCCAAGTACCTTCTAG -3'
(R):5'- GTTCTTTAGAACCAGGGTGAACAC -3'

Posted On

2022-11-14